Incidental Mutation 'R9499:Apoa5'
ID 717433
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9499 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 46268633-46271919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 46270646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 340 (R340P)
Ref Sequence ENSEMBL: ENSMUSP00000034584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
AlphaFold Q8C7G5
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T C 14: 8,028,329 I20T possibly damaging Het
Aes T C 10: 81,564,154 V62A probably damaging Het
Arhgap21 A T 2: 20,881,586 V270E probably damaging Het
Arhgef17 T C 7: 100,876,895 M851V possibly damaging Het
Arhgef5 A T 6: 43,284,006 H1455L Het
Birc6 T A 17: 74,609,069 L1660Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep120 C A 18: 53,685,961 R886L possibly damaging Het
Cep290 T C 10: 100,536,867 S1176P probably damaging Het
Cyp2j7 C T 4: 96,227,603 R202H probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Depdc7 C T 2: 104,722,875 probably null Het
Erbb4 G A 1: 68,740,483 Q45* probably null Het
Ercc6 C T 14: 32,562,568 R763C probably damaging Het
Gm14124 C A 2: 150,267,936 T182K unknown Het
Gm14401 C T 2: 177,086,544 A141V probably benign Het
Gm14496 A G 2: 181,996,386 K418E probably benign Het
Gm8159 T A 14: 4,635,265 I161K probably damaging Het
Hnrnpk A G 13: 58,396,244 S116P probably benign Het
Hs3st6 T C 17: 24,758,254 L236P probably damaging Het
Il15 T A 8: 82,334,548 H100L probably benign Het
Inpp5f A T 7: 128,693,713 I744F possibly damaging Het
Kif14 C A 1: 136,527,481 S1630R probably damaging Het
Lrrc6 T C 15: 66,489,634 E6G probably damaging Het
Madd T C 2: 91,170,089 T544A probably damaging Het
Mbl2 G A 19: 30,239,264 A159T probably damaging Het
Mfsd9 T C 1: 40,773,992 T388A probably damaging Het
Mtor C T 4: 148,514,940 R1482C probably damaging Het
Myh11 T A 16: 14,246,809 E215V Het
Nmd3 T C 3: 69,739,996 V277A possibly damaging Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Nrxn1 T C 17: 90,630,022 K669R probably damaging Het
Patl1 T A 19: 11,920,364 M105K possibly damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Pdzrn3 T C 6: 101,150,894 D937G probably damaging Het
Phb G A 11: 95,671,431 V45I probably benign Het
Pi4ka T C 16: 17,307,710 E1187G Het
Piezo2 T C 18: 63,032,962 E2066G possibly damaging Het
Plin1 T C 7: 79,722,796 N343D probably benign Het
Polr1b C T 2: 129,115,764 R580* probably null Het
Rexo5 A G 7: 119,805,257 E192G probably damaging Het
Rpain T C 11: 70,974,990 S194P probably damaging Het
Slco6c1 T C 1: 97,128,102 S25G probably benign Het
Slitrk5 C T 14: 111,679,064 T40I probably benign Het
Slu7 G A 11: 43,438,268 V106I probably benign Het
Ssb T A 2: 69,866,638 D107E probably benign Het
Stc2 A G 11: 31,360,332 S235P probably benign Het
Sult2a8 A C 7: 14,423,562 V116G probably damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tgm1 T C 14: 55,713,476 probably benign Het
Trf C T 9: 103,222,084 V339I probably benign Het
Ucp1 T C 8: 83,297,880 L278P probably damaging Het
Vmn1r24 T A 6: 57,956,165 I123F possibly damaging Het
Vmn2r9 T A 5: 108,847,718 N355Y probably damaging Het
Yipf4 T C 17: 74,499,029 F221S probably damaging Het
Zfp595 A T 13: 67,317,003 S402T probably damaging Het
Zfp710 A G 7: 80,081,873 E266G probably damaging Het
Zfp827 T G 8: 79,060,774 W190G probably damaging Het
Zscan4c T C 7: 11,006,926 V124A probably benign Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46270652 missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46269139 critical splice donor site probably null
R0046:Apoa5 UTSW 9 46269998 missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46270549 nonsense probably null
R2007:Apoa5 UTSW 9 46270367 missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46270043 missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46269117 missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46270580 missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46270529 missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46269872 missense probably benign 0.12
R4760:Apoa5 UTSW 9 46270295 missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46270496 missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46270589 missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46269309 missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46270633 nonsense probably null
R6849:Apoa5 UTSW 9 46270000 missense probably benign 0.03
R7170:Apoa5 UTSW 9 46270139 missense probably benign 0.00
R9268:Apoa5 UTSW 9 46270421 missense probably benign 0.18
R9403:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
R9495:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46269119 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGCTTTTCGGCATGACAC -3'
(R):5'- GAGTGTAATGCCCCTGAGTAGG -3'

Sequencing Primer
(F):5'- ATGACACCTACCTGCAGATTGCTG -3'
(R):5'- TTGGGACAGCAGCACCTTTG -3'
Posted On 2022-07-18