Incidental Mutation 'R9729:Sclt1'
ID 731205
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Name sodium channel and clathrin linker 1
Synonyms 2610207F23Rik, 4931421F20Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R9729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 41626720-41742514 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 41675402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 325 (E325*)
Ref Sequence ENSEMBL: ENSMUSP00000026866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
AlphaFold G5E861
Predicted Effect probably null
Transcript: ENSMUST00000026866
AA Change: E325*
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834
AA Change: E325*

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146125
Predicted Effect probably null
Transcript: ENSMUST00000148769
AA Change: E325*
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834
AA Change: E325*

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,706 M273K probably benign Het
Aar2 A G 2: 156,551,441 D250G probably benign Het
Acly T A 11: 100,516,885 Y213F probably benign Het
Adgrg5 G A 8: 94,941,505 M399I Het
Adhfe1 T C 1: 9,553,409 L95P probably damaging Het
Ano7 G A 1: 93,394,458 C396Y probably damaging Het
Apob T A 12: 8,016,125 Y4365N probably damaging Het
Arfgap3 C T 15: 83,308,165 R411H probably damaging Het
Bbs7 T C 3: 36,607,669 Y127C probably damaging Het
Cadps2 T C 6: 23,382,983 T793A probably benign Het
Casp8ap2 T A 4: 32,643,807 V960E possibly damaging Het
Cdkl3 A G 11: 52,004,943 T6A probably benign Het
Cdkn2aip T C 8: 47,713,619 D51G probably benign Het
Cdpf1 G T 15: 85,808,326 S52* probably null Het
Celf5 T A 10: 81,468,091 D177V probably damaging Het
Cep164 A G 9: 45,771,599 V931A probably damaging Het
Cog6 T C 3: 52,993,486 D457G probably damaging Het
Col4a2 G T 8: 11,446,157 V1593L probably benign Het
Dlg5 C G 14: 24,154,613 M1287I probably benign Het
Dmrt1 T C 19: 25,545,998 S238P probably benign Het
Dpysl2 A G 14: 66,862,478 M103T probably benign Het
Emsy C A 7: 98,613,049 A608S probably benign Het
Exoc5 A T 14: 49,015,629 C576S probably damaging Het
F830016B08Rik G A 18: 60,300,486 V214M possibly damaging Het
Fam189a1 C T 7: 65,156,308 G6S probably benign Het
Fignl1 A G 11: 11,802,219 S279P probably benign Het
Gimap1 A G 6: 48,742,452 R71G unknown Het
Gm26727 A T 2: 67,432,919 M88K probably damaging Het
Gm45861 T A 8: 27,555,408 W1066R unknown Het
Gm609 G T 16: 45,443,874 T107N possibly damaging Het
Gpr15 A G 16: 58,717,886 L280S possibly damaging Het
Grin1 C T 2: 25,297,410 W629* probably null Het
Grk5 C T 19: 61,090,029 P508L possibly damaging Het
Hgf A T 5: 16,561,031 D55V probably damaging Het
Hipk1 T A 3: 103,761,574 D502V probably damaging Het
Kmt2c T C 5: 25,284,760 K4394E probably damaging Het
Llgl2 A G 11: 115,849,641 T388A probably damaging Het
Lsm14a G T 7: 34,389,473 S2R probably damaging Het
Madd A T 2: 91,170,199 M507K possibly damaging Het
Map2k3 G T 11: 60,946,646 V191L Het
Mapk8ip1 A G 2: 92,386,715 S421P probably damaging Het
March7 C T 2: 60,234,441 R354* probably null Het
Myc T G 15: 61,988,086 C204G probably damaging Het
Nampt A G 12: 32,850,529 H491R possibly damaging Het
Noct C T 3: 51,249,846 Q202* probably null Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1358 T A 10: 78,520,115 F169Y probably damaging Het
Osbpl10 G A 9: 115,223,736 V451M probably damaging Het
Osr2 T A 15: 35,302,915 F312Y probably benign Het
Parp16 A T 9: 65,229,815 I108F possibly damaging Het
Parp4 A G 14: 56,648,431 T1656A unknown Het
Pnpla8 A G 12: 44,283,874 I374V probably benign Het
Prss23 T C 7: 89,510,723 N46S probably benign Het
Ptger2 T C 14: 44,989,019 W19R possibly damaging Het
Rbl2 T C 8: 91,078,899 S195P probably damaging Het
Rnf169 C T 7: 99,926,270 V373I probably damaging Het
Sdccag3 A G 2: 26,388,633 F21S unknown Het
Sergef C T 7: 46,635,489 S43N probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc3a2 T C 19: 8,708,006 D472G probably damaging Het
Slc43a3 T C 2: 84,950,456 F342L probably benign Het
Slc44a4 A T 17: 34,921,694 I288F probably benign Het
Snupn T A 9: 56,970,631 N151K possibly damaging Het
Srbd1 A T 17: 86,130,122 D264E probably benign Het
Srpr A T 9: 35,214,273 T378S probably benign Het
Stat4 A G 1: 52,102,603 D613G possibly damaging Het
Sycp2l C T 13: 41,172,656 P246L Het
Tcf20 T C 15: 82,851,836 R1805G probably benign Het
Tob1 T A 11: 94,214,054 F139I probably damaging Het
Traj9 A G 14: 54,209,414 T8A unknown Het
Trank1 G T 9: 111,391,469 D2425Y probably damaging Het
Ttn A T 2: 76,746,923 M24542K probably damaging Het
Ttn G A 2: 76,907,727 S4202L unknown Het
Vcam1 T C 3: 116,117,456 Y431C probably damaging Het
Vcpkmt G A 12: 69,581,162 R175C probably damaging Het
Vmn2r51 A T 7: 10,105,552 D36E probably benign Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Zfp831 T C 2: 174,646,145 L871P possibly damaging Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5502:Sclt1 UTSW 3 41657275 missense probably benign 0.28
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R5710:Sclt1 UTSW 3 41663963 nonsense probably null
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6274:Sclt1 UTSW 3 41629516 critical splice donor site probably null
R6765:Sclt1 UTSW 3 41730902 missense unknown
R7171:Sclt1 UTSW 3 41717760 missense probably benign 0.00
R7489:Sclt1 UTSW 3 41629597 missense probably damaging 0.99
R7988:Sclt1 UTSW 3 41663454 makesense probably null
R8040:Sclt1 UTSW 3 41657376 missense probably damaging 1.00
R8158:Sclt1 UTSW 3 41671482 missense probably benign 0.36
R8383:Sclt1 UTSW 3 41742015 missense probably benign 0.13
R8956:Sclt1 UTSW 3 41681774 missense probably benign 0.01
R8971:Sclt1 UTSW 3 41727106 missense probably benign 0.01
R9227:Sclt1 UTSW 3 41711196 missense probably benign 0.01
R9230:Sclt1 UTSW 3 41711196 missense probably benign 0.01
R9463:Sclt1 UTSW 3 41647496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACATTTATTCAGTAGCTGCTGATC -3'
(R):5'- AGCTGACCATGGTATGATTTTGTTCAG -3'

Sequencing Primer
(F):5'- AGTAGCTGCTGATCCTTTCATTG -3'
(R):5'- TGGTATGATTTTGTTCAGAATACCC -3'
Posted On 2022-10-06