Incidental Mutation 'R0838:Slc1a6'
ID78049
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0838 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78796222 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 294 (D294V)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490] [ENSMUST00000217717]
Predicted Effect probably damaging
Transcript: ENSMUST00000005490
AA Change: D294V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: D294V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217717
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78814431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTACAGCACACGAGTGGTGAC -3'
(R):5'- ACCAATGCACAGATGTATGACGACC -3'

Sequencing Primer
(F):5'- TCCTGGAAAATGTCACCCG -3'
(R):5'- gcacagatgtatgaCGACCAAATG -3'
Posted On2013-10-16