Mutagenetix > Incidental Mutation

Incidental Mutation 'R8068:Slc1a6'

620116

Institutional Source

Beutler Lab

Gene Symbol

Slc1a6

Ensembl Gene

ENSMUSG00000005357

Gene Name

solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6

Synonyms

EAAT4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R8068 (G1)

Quality Score

110.008

Status

Not validated

Chromosome

Chromosomal Location

78780496-78814765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 78812872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 476 (V476L)

Ref Sequence

ENSEMBL: ENSMUSP00000005490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005490]

AlphaFold

O35544

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005490
AA Change: V476L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: V476L

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:SDF	55	519	8.5e-129	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	A	8: 40,825,938	D455E	not run	Het
Aldoc	T	C	11: 78,324,727	F79S	possibly damaging	Het
Atmin	A	G	8: 116,956,650	S350G	probably benign	Het
Bms1	A	G	6: 118,413,750	F206S	probably damaging	Het
Carmil1	T	A	13: 24,075,728	I698L	probably benign	Het
Cd47	T	A	16: 49,895,416	S182T		Het
Ces2e	G	T	8: 104,932,997		probably null	Het
Cit	C	A	5: 115,952,466	H906Q	probably damaging	Het
Cit	T	C	5: 115,982,235	S1370P	probably benign	Het
Dchs2	T	C	3: 83,300,438	F1739L	probably benign	Het
Dlx4	T	C	11: 95,145,330	Y51C	possibly damaging	Het
Drosha	T	A	15: 12,883,190	Y796*	probably null	Het
Elf1	T	A	14: 79,536,390	F14I	probably benign	Het
Fam135b	T	C	15: 71,532,978	Q73R	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gls2	C	G	10: 128,195,114	R81G	unknown	Het
Hnrnpll	T	C	17: 80,050,852	M157V	possibly damaging	Het
Itgb3	T	A	11: 104,665,511	M726K	probably benign	Het
Kcna10	T	G	3: 107,194,410	M119R	possibly damaging	Het
Kcnh1	A	G	1: 192,241,942	T155A	probably benign	Het
Kctd9	T	A	14: 67,724,662	D51E	unknown	Het
Lgr6	T	C	1: 135,063,664	I129V	probably benign	Het
Lrrfip1	A	T	1: 91,128,102	D598V	probably damaging	Het
Ltbp4	G	T	7: 27,324,168	Q850K	probably damaging	Het
Mdm1	A	G	10: 118,146,804	R115G	possibly damaging	Het
Mns1	A	C	9: 72,448,527		probably null	Het
Mthfs	G	A	9: 89,211,235	R14Q	probably damaging	Het
Muc2	T	A	7: 141,744,685	S25T		Het
Ncapd3	T	C	9: 27,063,361	S710P	possibly damaging	Het
Nrip1	T	A	16: 76,292,953	H572L	possibly damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1020	A	G	2: 85,849,806	E118G	probably damaging	Het
Olfr1152	A	G	2: 87,868,651	Y220C	probably benign	Het
Olfr656	T	A	7: 104,618,253	C191*	probably null	Het
Opa3	A	G	7: 19,244,985	E125G	probably damaging	Het
P3h1	A	G	4: 119,236,862	Y238C	probably damaging	Het
Pappa2	T	C	1: 158,935,985	D652G	possibly damaging	Het
Pcdha11	T	A	18: 37,005,565	N82K	probably damaging	Het
Pde4b	T	C	4: 102,596,015	I293T	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Qk	T	C	17: 10,318,803	D24G	possibly damaging	Het
Rbpjl	A	G	2: 164,408,518	K197E	possibly damaging	Het
Rnf111	A	T	9: 70,457,941	S415T	probably benign	Het
Scyl1	A	G	19: 5,760,825	V488A	probably damaging	Het
Slc22a17	A	T	14: 54,908,908	F84I	probably benign	Het
Slc22a4	A	C	11: 53,997,443	I253S	possibly damaging	Het
Speer2	T	C	16: 69,860,524	H77R	possibly damaging	Het
Speg	T	C	1: 75,422,250	S2114P	probably damaging	Het
Synpo2	T	A	3: 123,117,392	R201S	possibly damaging	Het
Ttpa	C	A	4: 20,028,419	H225Q	probably damaging	Het
Vmn1r45	A	T	6: 89,933,279	H236Q	possibly damaging	Het
Vmn2r7	A	T	3: 64,716,086	V271D	probably benign	Het
Wdr66	A	G	5: 123,256,166	S373G	not run	Het
Zfp53	A	T	17: 21,509,012	T436S	probably benign	Het

Other mutations in Slc1a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Slc1a6	APN	10	78801813	missense	probably damaging	1.00
IGL00496:Slc1a6	APN	10	78793308	missense	probably damaging	1.00
IGL01099:Slc1a6	APN	10	78788997	missense	possibly damaging	0.67
IGL02299:Slc1a6	APN	10	78793303	missense	probably damaging	1.00
IGL02677:Slc1a6	APN	10	78789064	missense	probably damaging	1.00
IGL02705:Slc1a6	APN	10	78801954	missense	probably damaging	1.00
IGL03024:Slc1a6	APN	10	78814608	missense	probably benign
IGL03185:Slc1a6	APN	10	78801907	missense	probably damaging	1.00
IGL03046:Slc1a6	UTSW	10	78800174	missense	probably benign	0.19
R0183:Slc1a6	UTSW	10	78791233	missense	probably damaging	1.00
R0373:Slc1a6	UTSW	10	78801922	nonsense	probably null
R0730:Slc1a6	UTSW	10	78796008	missense	probably benign	0.13
R0774:Slc1a6	UTSW	10	78812824	missense	probably benign	0.03
R0838:Slc1a6	UTSW	10	78796222	missense	probably damaging	1.00
R1449:Slc1a6	UTSW	10	78800117	missense	probably damaging	0.99
R1822:Slc1a6	UTSW	10	78812931	nonsense	probably null
R1853:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1854:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1855:Slc1a6	UTSW	10	78812924	missense	probably damaging	0.97
R1866:Slc1a6	UTSW	10	78791349	missense	probably damaging	0.99
R2073:Slc1a6	UTSW	10	78800130	missense	possibly damaging	0.93
R2279:Slc1a6	UTSW	10	78789048	missense	probably benign	0.12
R2360:Slc1a6	UTSW	10	78812884	missense	possibly damaging	0.91
R2939:Slc1a6	UTSW	10	78814614	makesense	probably null
R3111:Slc1a6	UTSW	10	78789081	missense	probably damaging	0.99
R3926:Slc1a6	UTSW	10	78812881	missense	possibly damaging	0.91
R4116:Slc1a6	UTSW	10	78787889	missense	probably benign	0.00
R4798:Slc1a6	UTSW	10	78800118	missense	probably damaging	1.00
R4916:Slc1a6	UTSW	10	78796251	missense	probably damaging	1.00
R5054:Slc1a6	UTSW	10	78814602	missense	probably damaging	1.00
R5166:Slc1a6	UTSW	10	78796269	critical splice donor site	probably null
R5304:Slc1a6	UTSW	10	78793307	missense	probably damaging	1.00
R5367:Slc1a6	UTSW	10	78787803	missense	probably damaging	1.00
R5554:Slc1a6	UTSW	10	78795982	missense	probably benign	0.00
R5635:Slc1a6	UTSW	10	78789091	missense	possibly damaging	0.67
R5773:Slc1a6	UTSW	10	78793277	splice site	probably null
R6117:Slc1a6	UTSW	10	78788988	missense	possibly damaging	0.72
R6167:Slc1a6	UTSW	10	78801837	missense	probably benign	0.40
R6174:Slc1a6	UTSW	10	78801907	missense	probably damaging	1.00
R6221:Slc1a6	UTSW	10	78800076	missense	probably damaging	0.98
R6323:Slc1a6	UTSW	10	78812887	missense	probably damaging	1.00
R6339:Slc1a6	UTSW	10	78800085	missense	possibly damaging	0.94
R6670:Slc1a6	UTSW	10	78787812	missense	probably benign	0.00
R7166:Slc1a6	UTSW	10	78812812	missense	possibly damaging	0.96
R7292:Slc1a6	UTSW	10	78814604	missense	possibly damaging	0.84
R7548:Slc1a6	UTSW	10	78814431	missense	probably damaging	1.00
R7779:Slc1a6	UTSW	10	78795955	missense	probably damaging	0.96
R7843:Slc1a6	UTSW	10	78796260	missense	probably damaging	1.00
R8190:Slc1a6	UTSW	10	78791233	missense	probably damaging	1.00
R8210:Slc1a6	UTSW	10	78796257	missense	possibly damaging	0.95
R8846:Slc1a6	UTSW	10	78801947	missense	probably damaging	1.00
R9216:Slc1a6	UTSW	10	78801858	missense	probably damaging	1.00
R9660:Slc1a6	UTSW	10	78812864	missense	probably benign	0.06
R9798:Slc1a6	UTSW	10	78793333	critical splice donor site	probably null
Z1176:Slc1a6	UTSW	10	78796075	missense	possibly damaging	0.65
Z1177:Slc1a6	UTSW	10	78791267	missense	possibly damaging	0.79
Z1177:Slc1a6	UTSW	10	78812894	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCATCACACATTTTGCTTTCATG -3'
(R):5'- TAGAGAGCCATCCCAATGCCTC -3'

Sequencing Primer
(F):5'- CACATTTTGCTTTCATGATGTCAAC -3'
(R):5'- ATGCCTCCCTCACCATCTAAC -3'

Posted On

2020-01-23