Incidental Mutation 'R0891:Arhgap12'
ID83520
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene NameRho GTPase activating protein 12
Synonyms2810011M08Rik
MMRRC Submission 039054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0891 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6024427-6136098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6026699 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 720 (T720A)
Ref Sequence ENSEMBL: ENSMUSP00000138444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
Predicted Effect probably damaging
Transcript: ENSMUST00000062584
AA Change: T750A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: T750A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077128
AA Change: T767A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: T767A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182066
AA Change: T745A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: T745A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182213
AA Change: T797A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: T797A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182383
AA Change: T720A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: T720A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182559
AA Change: T792A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: T792A

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Meta Mutation Damage Score 0.5378 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,290 N567K possibly damaging Het
9930021J03Rik G A 19: 29,717,653 T1547I probably damaging Het
Afap1 G A 5: 35,961,852 probably null Het
Angel2 G T 1: 190,945,073 K517N possibly damaging Het
Ankrd36 A G 11: 5,687,316 E1295G possibly damaging Het
Ankrd45 A G 1: 161,155,336 N139S possibly damaging Het
Ano3 T C 2: 110,697,976 T498A probably benign Het
Brsk1 A G 7: 4,704,227 S260G possibly damaging Het
Calml3 A G 13: 3,803,926 F93S probably damaging Het
Ccnf G T 17: 24,226,777 H498Q possibly damaging Het
Col27a1 A C 4: 63,305,183 probably null Het
Cpne5 A G 17: 29,202,919 probably benign Het
Dcst1 G A 3: 89,353,277 T560I probably benign Het
Fndc7 A G 3: 108,870,588 Y351H possibly damaging Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm5415 T A 1: 32,546,361 H156L possibly damaging Het
Kcnh8 A T 17: 52,905,214 D680V probably damaging Het
Kmt2d A G 15: 98,852,691 probably benign Het
Lrrfip1 T A 1: 91,068,615 I50N probably damaging Het
Mbip A T 12: 56,340,457 D132E possibly damaging Het
Nipal3 A T 4: 135,468,587 I235N possibly damaging Het
Nup93 T A 8: 94,281,263 probably benign Het
Olfr1347 T A 7: 6,488,472 Y134F probably damaging Het
Olfr524 A G 7: 140,202,459 Y104H probably damaging Het
Pgbd1 T C 13: 21,422,800 Y408C probably damaging Het
Pigo G A 4: 43,020,519 Q808* probably null Het
Pik3r1 A T 13: 101,701,466 N299K probably benign Het
Pip5k1a A G 3: 95,065,520 probably benign Het
Sept5 G C 16: 18,624,845 T118R probably damaging Het
Smarcal1 T C 1: 72,598,856 V483A probably damaging Het
Togaram1 A G 12: 64,982,647 D948G probably benign Het
Vmn2r75 A T 7: 86,164,268 V442E possibly damaging Het
Zfp57 A G 17: 37,006,176 K46E probably damaging Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6057576 missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6061853 missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6027613 missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6111857 missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6031766 missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6111936 missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6061982 intron probably benign
R0330:Arhgap12 UTSW 18 6039382 missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6064433 intron probably benign
R1123:Arhgap12 UTSW 18 6031822 missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6037058 missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6112340 missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6037057 missense probably benign 0.36
R3824:Arhgap12 UTSW 18 6061930 missense possibly damaging 0.80
R4181:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4182:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6112170 nonsense probably null
R5539:Arhgap12 UTSW 18 6111932 missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6037016 critical splice donor site probably null
R6859:Arhgap12 UTSW 18 6111803 missense probably damaging 1.00
R6960:Arhgap12 UTSW 18 6111901 missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6028056 missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6111920 missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6065709 missense possibly damaging 0.92
R8048:Arhgap12 UTSW 18 6052883 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGGGACTCACAGAGTTGTCCTTAC -3'
(R):5'- GCAGCCAGACAGAAGTCTACATGG -3'

Sequencing Primer
(F):5'- GAGTCACTGCTTGGTCCAAAATG -3'
(R):5'- TCTACATGGCTAAACGAGGTG -3'
Posted On2013-11-08