Incidental Mutation 'R1075:Supt20'
ID85592
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
MMRRC Submission 039161-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R1075 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 54706941 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 160 (Q160*)
Ref Sequence ENSEMBL: ENSMUSP00000143059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170552
AA Change: Q161*
SMART Domains Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: Q161*

DomainStartEndE-ValueType
Pfam:Spt20 63 229 6.8e-47 PFAM
low complexity region 425 441 N/A INTRINSIC
low complexity region 468 477 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197502
AA Change: Q160*
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: Q160*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199652
AA Change: Q160*
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: Q160*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199655
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199674
AA Change: Q160*
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: Q160*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200439
AA Change: Q160*
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: Q160*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200450
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Apbb2 G T 5: 66,302,678 P692Q probably damaging Het
Arhgap40 A G 2: 158,549,647 N627D possibly damaging Het
Asns G A 6: 7,676,076 R465* probably null Het
Bdkrb1 G A 12: 105,604,303 V43I probably benign Het
Bod1 T C 11: 31,671,514 D63G possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Csnka2ip T A 16: 64,477,947 K685* probably null Het
Dennd5a A T 7: 109,918,601 D609E probably benign Het
Dhx34 G C 7: 16,218,349 T117S probably benign Het
Dpp4 A T 2: 62,352,286 D550E probably benign Het
Enah C T 1: 181,956,501 R81K unknown Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Etnppl A T 3: 130,629,563 M298L probably benign Het
Fam81a G A 9: 70,110,274 R130* probably null Het
Fbxl3 A C 14: 103,095,403 H46Q probably benign Het
Gal3st1 A G 11: 3,998,509 I239V possibly damaging Het
Gm11127 C T 17: 36,056,146 G335D probably benign Het
Htra4 T C 8: 25,033,596 I318V probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Il7r T C 15: 9,516,457 N86S probably benign Het
Mettl17 A G 14: 51,889,606 N231D probably benign Het
Mki67 T C 7: 135,697,311 D1998G probably benign Het
Myh15 G T 16: 49,120,054 R789L possibly damaging Het
Myh7 A G 14: 54,987,403 V569A probably benign Het
Nell1 A G 7: 50,853,840 I617M probably damaging Het
Nlrp1b C G 11: 71,181,686 E444Q probably benign Het
Olfr124 T A 17: 37,805,769 L208* probably null Het
Olfr1330 T C 4: 118,893,205 S41P probably damaging Het
Olfr1373 T A 11: 52,144,850 I227F possibly damaging Het
Psmd2 T C 16: 20,659,959 S603P probably damaging Het
Slc4a2 T A 5: 24,439,057 I913N possibly damaging Het
Smyd4 T C 11: 75,400,338 Y589H probably damaging Het
Spag17 A G 3: 100,093,676 E1850G probably damaging Het
Srsf11 A T 3: 158,012,790 probably benign Het
Stra6 A T 9: 58,151,404 N488I possibly damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Uchl1 T A 5: 66,682,465 F117I probably damaging Het
Usf1 T A 1: 171,418,109 N307K probably benign Het
Zfp994 T A 17: 22,200,945 H341L probably damaging Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
R7592:Supt20 UTSW 3 54707122 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGAACCATTCACTACATGGTTGC -3'
(R):5'- GAACCTTGGTTTTGTCCAAGCATCC -3'

Sequencing Primer
(F):5'- CATTCACTACATGGTTGCTTATTTTG -3'
(R):5'- CTCTAACGTCAGCAAGGGAGC -3'
Posted On2013-11-18