Incidental Mutation 'R1075:Fam81a'
ID85614
Institutional Source Beutler Lab
Gene Symbol Fam81a
Ensembl Gene ENSMUSG00000032224
Gene Namefamily with sequence similarity 81, member A
Synonyms
MMRRC Submission 039161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1075 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70088511-70142560 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70110274 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 130 (R130*)
Ref Sequence ENSEMBL: ENSMUSP00000034749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034749]
Predicted Effect probably null
Transcript: ENSMUST00000034749
AA Change: R130*
SMART Domains Protein: ENSMUSP00000034749
Gene: ENSMUSG00000032224
AA Change: R130*

DomainStartEndE-ValueType
coiled coil region 75 106 N/A INTRINSIC
coiled coil region 158 187 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Apbb2 G T 5: 66,302,678 P692Q probably damaging Het
Arhgap40 A G 2: 158,549,647 N627D possibly damaging Het
Asns G A 6: 7,676,076 R465* probably null Het
Bdkrb1 G A 12: 105,604,303 V43I probably benign Het
Bod1 T C 11: 31,671,514 D63G possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Csnka2ip T A 16: 64,477,947 K685* probably null Het
Dennd5a A T 7: 109,918,601 D609E probably benign Het
Dhx34 G C 7: 16,218,349 T117S probably benign Het
Dpp4 A T 2: 62,352,286 D550E probably benign Het
Enah C T 1: 181,956,501 R81K unknown Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Etnppl A T 3: 130,629,563 M298L probably benign Het
Fbxl3 A C 14: 103,095,403 H46Q probably benign Het
Gal3st1 A G 11: 3,998,509 I239V possibly damaging Het
Gm11127 C T 17: 36,056,146 G335D probably benign Het
Htra4 T C 8: 25,033,596 I318V probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Il7r T C 15: 9,516,457 N86S probably benign Het
Mettl17 A G 14: 51,889,606 N231D probably benign Het
Mki67 T C 7: 135,697,311 D1998G probably benign Het
Myh15 G T 16: 49,120,054 R789L possibly damaging Het
Myh7 A G 14: 54,987,403 V569A probably benign Het
Nell1 A G 7: 50,853,840 I617M probably damaging Het
Nlrp1b C G 11: 71,181,686 E444Q probably benign Het
Olfr124 T A 17: 37,805,769 L208* probably null Het
Olfr1330 T C 4: 118,893,205 S41P probably damaging Het
Olfr1373 T A 11: 52,144,850 I227F possibly damaging Het
Psmd2 T C 16: 20,659,959 S603P probably damaging Het
Slc4a2 T A 5: 24,439,057 I913N possibly damaging Het
Smyd4 T C 11: 75,400,338 Y589H probably damaging Het
Spag17 A G 3: 100,093,676 E1850G probably damaging Het
Srsf11 A T 3: 158,012,790 probably benign Het
Stra6 A T 9: 58,151,404 N488I possibly damaging Het
Supt20 C T 3: 54,706,941 Q160* probably null Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Uchl1 T A 5: 66,682,465 F117I probably damaging Het
Usf1 T A 1: 171,418,109 N307K probably benign Het
Zfp994 T A 17: 22,200,945 H341L probably damaging Het
Other mutations in Fam81a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam81a APN 9 70099152 nonsense probably null
IGL02010:Fam81a APN 9 70099137 missense probably benign 0.04
IGL02891:Fam81a APN 9 70110276 missense probably damaging 1.00
R0100:Fam81a UTSW 9 70102809 splice site probably benign
R0497:Fam81a UTSW 9 70096119 missense possibly damaging 0.47
R0621:Fam81a UTSW 9 70093647 missense probably benign 0.35
R1524:Fam81a UTSW 9 70125108 missense probably damaging 1.00
R4970:Fam81a UTSW 9 70093590 nonsense probably null
R5138:Fam81a UTSW 9 70099175 missense probably benign 0.01
R5209:Fam81a UTSW 9 70125160 missense probably benign 0.06
R6139:Fam81a UTSW 9 70102818 critical splice donor site probably null
R6378:Fam81a UTSW 9 70110346 missense probably damaging 1.00
R7145:Fam81a UTSW 9 70110278 missense probably damaging 1.00
R8030:Fam81a UTSW 9 70102909 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGAGCACTTTACTCCCTGAGCATCT -3'
(R):5'- TGAGTCGAGCACTCATATACTTTCCTGA -3'

Sequencing Primer
(F):5'- gcgaaactgaagagggaaaaac -3'
(R):5'- TCCTGAATTATGAAATGGACACG -3'
Posted On2013-11-18