Incidental Mutation 'FR4548:Supt20'
ID 512016
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Name SPT20 SAGA complex component
Synonyms p38IP, Fam48a, p38 interacting protein, D3Ertd300e
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # FR4548 ()
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 54600228-54636187 bp(+) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CA to CAGCAGAA at 54635094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000197502] [ENSMUST00000200441] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000153224] [ENSMUST00000154787]
AlphaFold Q7TT00
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect probably benign
Transcript: ENSMUST00000197502
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,634,886 (GRCm39) probably benign Het
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
Ahdc1 T TCCC 4: 132,790,071 (GRCm39) probably benign Homo
Ahdc1 TCC TCCCCC 4: 132,790,068 (GRCm39) probably benign Homo
AI837181 CGG CGGGGG 19: 5,475,259 (GRCm39) probably benign Het
AI837181 CG CGGGG 19: 5,475,265 (GRCm39) probably benign Het
Anxa2 CCC CCCTCC 9: 69,387,485 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apol6 T TGTTA 15: 76,935,645 (GRCm39) probably null Homo
Blm CTAC CTACTTAC 7: 80,113,517 (GRCm39) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Bud31 C T 5: 145,083,345 (GRCm39) R63C probably benign Het
C4b C T 17: 34,959,971 (GRCm39) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1f AGG AGGGGG X: 7,486,297 (GRCm39) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,511,026 (GRCm39) probably benign Het
Cckbr GGGC G 7: 105,083,888 (GRCm39) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,306,681 (GRCm39) probably benign Homo
Ces1b T C 8: 93,794,720 (GRCm39) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,631,999 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,080,420 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,405 (GRCm39) probably benign Het
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm GTGA GTGAATGA 13: 61,685,651 (GRCm39) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,726 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,241,729 (GRCm39) probably benign Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TTC TTCATC 2: 57,938,087 (GRCm39) probably benign Het
Ermn TC TCTCC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,244 (GRCm39) probably null Het
Fscb T A 12: 64,519,339 (GRCm39) Q709L unknown Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Glod4 A C 11: 76,134,136 (GRCm39) probably benign Homo
Gm14401 A G 2: 176,778,661 (GRCm39) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,934 (GRCm39) probably benign Het
Gm4340 AGC AGCCGC 10: 104,031,931 (GRCm39) probably benign Het
Gm8104 T C 14: 42,967,468 (GRCm39) S179P probably damaging Het
Gm8104 C T 14: 42,967,466 (GRCm39) T178I probably benign Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 79,149,604 (GRCm39) probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Ifi211 G A 1: 173,733,759 (GRCm39) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 67,875,934 (GRCm39) probably benign Het
Igkv9-129 G A 6: 67,817,018 (GRCm39) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,314,013 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,198,814 (GRCm39) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,285,805 (GRCm39) probably benign Het
Kng2 G A 16: 22,819,302 (GRCm39) Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,192,346 (GRCm39) probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,280,102 (GRCm39) probably benign Homo
Las1l TC TCTTCCGC X: 94,984,231 (GRCm39) probably benign Het
Las1l GAG GAGAAG X: 94,984,429 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,462 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,465 (GRCm39) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,270,499 (GRCm39) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,872,826 (GRCm39) probably benign Homo
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Mn1 GCA GCACCA 5: 111,567,564 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,067,582 (GRCm39) probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,067,583 (GRCm39) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,549,752 (GRCm39) probably benign Het
Nacad GG GGCCAGTG 11: 6,549,760 (GRCm39) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,150,559 (GRCm39) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 35,073,046 (GRCm39) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,716,458 (GRCm39) probably benign Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l GC GCTTC 4: 156,324,557 (GRCm39) probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,119,228 (GRCm39) probably benign Homo
Or2ak5 T G 11: 58,611,197 (GRCm39) I226L probably benign Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Homo
Or51v8 CAAA CAAAAAA 7: 103,320,167 (GRCm39) probably benign Homo
Or51v8 G GAAC 7: 103,320,174 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Osmr CTC CTCTTC 15: 6,867,184 (GRCm39) probably benign Homo
Patl2 GCT GCTCCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,006,823 (GRCm39) probably benign Homo
Phldb3 GACCC G 7: 24,328,403 (GRCm39) probably null Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Polr1g GGATG GG 7: 19,091,169 (GRCm39) probably benign Homo
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,571,039 (GRCm39) probably benign Homo
Prr13 TCC TCCGCC 15: 102,370,609 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Homo
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,891,419 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,599,199 (GRCm39) probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,384,485 (GRCm39) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,646,819 (GRCm39) probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,373,064 (GRCm39) probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,373,065 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GGC GGCCGC 17: 85,928,791 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 124,996,134 (GRCm39) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,570 (GRCm39) probably benign Het
Spata31h1 G GTCATTA 10: 82,126,830 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Syne1 C A 10: 4,982,969 (GRCm39) S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,105,281 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,295 (GRCm39) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm39) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Het
Triobp TCG TCGCCG 15: 78,877,590 (GRCm39) probably benign Homo
Triobp TCG TCGGCG 15: 78,877,587 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,039 (GRCm39) probably benign Het
Tsen2 GAG GAGAAG 6: 115,537,029 (GRCm39) probably benign Het
Ttf2 TC TCCGC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,223,540 (GRCm39) probably benign Het
Ubtf CTC CTCATC 11: 102,197,784 (GRCm39) probably benign Het
Utrn T TTCCTGTC 10: 12,509,685 (GRCm39) probably benign Homo
Vars1 TGG TGGAGTCCTGGGGGG 17: 35,234,965 (GRCm39) probably benign Homo
Vars1 G GAGTCCTGGGTGC 17: 35,234,967 (GRCm39) probably benign Het
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,561,039 (GRCm39) probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,930,607 (GRCm39) probably null Het
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,749,392 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Zfp986 G T 4: 145,625,928 (GRCm39) R196I probably benign Het
Zfp992 G T 4: 146,550,464 (GRCm39) E62* probably null Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54,622,590 (GRCm39) missense probably damaging 0.98
IGL01781:Supt20 APN 3 54,602,626 (GRCm39) start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54,622,945 (GRCm39) intron probably benign
IGL02656:Supt20 APN 3 54,615,816 (GRCm39) missense probably damaging 1.00
IGL02958:Supt20 APN 3 54,621,144 (GRCm39) intron probably benign
IGL03036:Supt20 APN 3 54,616,723 (GRCm39) nonsense probably null
IGL03128:Supt20 APN 3 54,615,708 (GRCm39) missense probably benign 0.05
IGL03164:Supt20 APN 3 54,620,609 (GRCm39) missense probably benign 0.01
FR4304:Supt20 UTSW 3 54,635,085 (GRCm39) nonsense probably null
FR4304:Supt20 UTSW 3 54,635,068 (GRCm39) small insertion probably benign
FR4304:Supt20 UTSW 3 54,635,083 (GRCm39) small insertion probably benign
FR4449:Supt20 UTSW 3 54,635,070 (GRCm39) small insertion probably benign
FR4548:Supt20 UTSW 3 54,635,085 (GRCm39) small insertion probably benign
FR4548:Supt20 UTSW 3 54,635,078 (GRCm39) small insertion probably benign
FR4589:Supt20 UTSW 3 54,635,092 (GRCm39) small insertion probably benign
FR4589:Supt20 UTSW 3 54,635,072 (GRCm39) small insertion probably benign
FR4589:Supt20 UTSW 3 54,635,076 (GRCm39) small insertion probably benign
FR4737:Supt20 UTSW 3 54,635,082 (GRCm39) small insertion probably benign
FR4737:Supt20 UTSW 3 54,635,078 (GRCm39) small insertion probably benign
FR4737:Supt20 UTSW 3 54,635,079 (GRCm39) small insertion probably benign
R0383:Supt20 UTSW 3 54,610,570 (GRCm39) nonsense probably null
R0675:Supt20 UTSW 3 54,614,390 (GRCm39) missense probably damaging 1.00
R0744:Supt20 UTSW 3 54,622,122 (GRCm39) missense probably damaging 1.00
R0968:Supt20 UTSW 3 54,615,821 (GRCm39) intron probably benign
R1075:Supt20 UTSW 3 54,614,362 (GRCm39) nonsense probably null
R1689:Supt20 UTSW 3 54,619,583 (GRCm39) nonsense probably null
R1772:Supt20 UTSW 3 54,617,841 (GRCm39) missense probably damaging 1.00
R1779:Supt20 UTSW 3 54,622,164 (GRCm39) missense probably benign 0.00
R1829:Supt20 UTSW 3 54,635,079 (GRCm39) utr 3 prime probably benign
R3236:Supt20 UTSW 3 54,616,501 (GRCm39) missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54,616,501 (GRCm39) missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54,602,555 (GRCm39) utr 5 prime probably benign
R5180:Supt20 UTSW 3 54,616,506 (GRCm39) missense probably benign 0.00
R5188:Supt20 UTSW 3 54,617,849 (GRCm39) missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54,616,746 (GRCm39) missense probably damaging 1.00
R5627:Supt20 UTSW 3 54,620,611 (GRCm39) missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54,619,628 (GRCm39) missense probably benign
R5995:Supt20 UTSW 3 54,616,474 (GRCm39) missense probably damaging 0.97
R6316:Supt20 UTSW 3 54,635,069 (GRCm39) small insertion probably benign
R6623:Supt20 UTSW 3 54,625,715 (GRCm39) missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54,606,022 (GRCm39) missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54,635,175 (GRCm39) splice site probably null
R6988:Supt20 UTSW 3 54,606,018 (GRCm39) missense probably damaging 1.00
R7149:Supt20 UTSW 3 54,635,832 (GRCm39) missense unknown
R7592:Supt20 UTSW 3 54,614,543 (GRCm39) missense probably damaging 0.97
R7940:Supt20 UTSW 3 54,620,620 (GRCm39) missense probably benign 0.04
R8480:Supt20 UTSW 3 54,614,537 (GRCm39) missense probably damaging 1.00
R8550:Supt20 UTSW 3 54,623,063 (GRCm39) missense possibly damaging 0.48
R8935:Supt20 UTSW 3 54,634,988 (GRCm39) critical splice acceptor site probably null
R9412:Supt20 UTSW 3 54,635,069 (GRCm39) small deletion probably benign
R9414:Supt20 UTSW 3 54,610,504 (GRCm39) missense probably damaging 1.00
R9694:Supt20 UTSW 3 54,623,015 (GRCm39) missense probably benign 0.02
RF001:Supt20 UTSW 3 54,635,083 (GRCm39) small insertion probably benign
RF009:Supt20 UTSW 3 54,635,083 (GRCm39) small insertion probably benign
RF010:Supt20 UTSW 3 54,635,083 (GRCm39) small insertion probably benign
RF014:Supt20 UTSW 3 54,635,086 (GRCm39) small insertion probably benign
RF026:Supt20 UTSW 3 54,635,091 (GRCm39) nonsense probably null
RF026:Supt20 UTSW 3 54,635,068 (GRCm39) small insertion probably benign
RF032:Supt20 UTSW 3 54,635,087 (GRCm39) small insertion probably benign
RF038:Supt20 UTSW 3 54,635,068 (GRCm39) small insertion probably benign
RF045:Supt20 UTSW 3 54,635,087 (GRCm39) small insertion probably benign
RF052:Supt20 UTSW 3 54,635,086 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCCAGGAATCAGTGATATACCC -3'
(R):5'- ACTCACTGCTCCAAGCTGAC -3'

Sequencing Primer
(F):5'- GATACTCGAATTGTACTGCTTCTAG -3'
(R):5'- GCTGACTGGCTTTTAACATGTCAGAC -3'
Posted On 2018-04-05