Mutagenetix > Incidental Mutation

Incidental Mutation 'R1051:Lenep'

93926

Institutional Source

Beutler Lab

Gene Symbol

Lenep

Ensembl Gene

ENSMUSG00000078173

Gene Name

lens epithelial protein

Synonyms

Lep503

MMRRC Submission

039141-MU

Accession Numbers

Essential gene?

Not available question?

Stock #

R1051 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89309203-89309957 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89309780 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 56 (I56N)

Ref Sequence

ENSEMBL: ENSMUSP00000052968 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050398] [ENSMUST00000057431] [ENSMUST00000107426] [ENSMUST00000129308]

AlphaFold

Q9WVB6

Predicted Effect

probably benign
Transcript: ENSMUST00000050398

SMART Domains

Protein: ENSMUSP00000051366
Gene: ENSMUSG00000042642

Domain	Start	End	E-Value	Type
MoCF_biosynth	19	180	7.52e-24	SMART
Pfam:PAPS_reduct	303	460	5.2e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057431
AA Change: I56N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000052968
Gene: ENSMUSG00000078173
AA Change: I56N

Domain	Start	End	E-Value	Type
Pfam:LEP503	1	61	6.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107426

SMART Domains

Protein: ENSMUSP00000103049
Gene: ENSMUSG00000042642

Domain	Start	End	E-Value	Type
MoCF_biosynth	19	180	7.52e-24	SMART
Pfam:PAPS_reduct	303	460	4.7e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126926

Predicted Effect

probably benign
Transcript: ENSMUST00000129308

SMART Domains

Protein: ENSMUSP00000122252
Gene: ENSMUSG00000042642

Domain	Start	End	E-Value	Type
MoCF_biosynth	19	180	7.52e-24	SMART
Pfam:PAPS_reduct	303	460	4.7e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153969

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ocular lens is a tissue of epithelial origin and devoid of blood vessels and nerves. Cells of the lens epithelium are responsible for the growth and maintenance of the lens through mitosis, protein synthesis, and active transport of ions and metabolites across the lens capsule. Lens epithelial protein is expressed exclusively in lens epithelial cells and may play a role in cell differentiation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	G	5: 121,764,143 (GRCm39)	S929P	probably damaging	Het
Acot1	T	C	12: 84,056,378 (GRCm39)	V32A	probably damaging	Het
Ank1	G	A	8: 23,583,956 (GRCm39)	G353D	probably damaging	Het
Baiap2l1	T	A	5: 144,222,943 (GRCm39)	H97L	probably damaging	Het
Casp8ap2	C	A	4: 32,640,790 (GRCm39)	P615T	probably benign	Het
Chrng	A	T	1: 87,136,785 (GRCm39)	D218V	possibly damaging	Het
Col5a3	C	A	9: 20,686,531 (GRCm39)	V1365L	unknown	Het
Ddx49	A	G	8: 70,747,335 (GRCm39)		probably null	Het
Dnaaf2	T	C	12: 69,244,569 (GRCm39)	D164G	probably damaging	Het
Eefsec	A	T	6: 88,274,829 (GRCm39)	D378E	probably benign	Het
Farsb	T	C	1: 78,420,287 (GRCm39)	I535V	possibly damaging	Het
Fat1	T	G	8: 45,497,543 (GRCm39)	S4343A	probably damaging	Het
Fbn2	T	C	18: 58,145,425 (GRCm39)	Y2737C	probably damaging	Het
Gtf3c1	T	C	7: 125,306,821 (GRCm39)	E10G	probably damaging	Het
Has1	T	C	17: 18,068,541 (GRCm39)	D271G	probably damaging	Het
Hsh2d	G	A	8: 72,954,304 (GRCm39)	D229N	probably benign	Het
Il12rb2	A	G	6: 67,333,719 (GRCm39)	F187L	probably benign	Het
Kdsr	G	A	1: 106,675,310 (GRCm39)	Q109*	probably null	Het
Klb	G	A	5: 65,536,670 (GRCm39)	A667T	probably damaging	Het
Krba1	C	T	6: 48,390,332 (GRCm39)	R704C	possibly damaging	Het
Lipc	T	C	9: 70,709,398 (GRCm39)	I450V	probably benign	Het
Myh6	T	C	14: 55,186,984 (GRCm39)	N1329S	probably benign	Het
Myo5c	T	A	9: 75,198,165 (GRCm39)	M1330K	probably benign	Het
Myo9b	A	G	8: 71,808,466 (GRCm39)	E1691G	probably damaging	Het
Ninl	C	G	2: 150,812,046 (GRCm39)	E240Q	probably damaging	Het
Nlgn1	T	C	3: 25,966,869 (GRCm39)	S195G	probably damaging	Het
Nlrp4c	A	G	7: 6,068,942 (GRCm39)	E281G	probably benign	Het
Olfm2	T	C	9: 20,579,759 (GRCm39)	T331A	probably damaging	Het
Or1o1	A	T	17: 37,717,341 (GRCm39)	I301F	possibly damaging	Het
Or2d2	T	A	7: 106,728,123 (GRCm39)	D159V	possibly damaging	Het
Or8b9	T	C	9: 37,766,657 (GRCm39)	I181T	probably damaging	Het
Plekhh2	T	C	17: 84,829,255 (GRCm39)		probably null	Het
Pramel4	A	G	4: 143,795,068 (GRCm39)	E485G	possibly damaging	Het
Prss12	A	G	3: 123,279,174 (GRCm39)	D417G	probably null	Het
Rhpn1	A	T	15: 75,584,241 (GRCm39)	Y456F	probably damaging	Het
Rnpc3	C	T	3: 113,423,595 (GRCm39)	E37K	possibly damaging	Het
Rp1l1	T	G	14: 64,269,984 (GRCm39)	L1857V	probably damaging	Het
Sdk2	C	T	11: 113,729,472 (GRCm39)		silent	Het
Sepsecs	C	T	5: 52,822,698 (GRCm39)	A18T	probably damaging	Het
Sgms1	T	A	19: 32,137,439 (GRCm39)	L42F	probably damaging	Het
Sipa1l1	A	T	12: 82,496,119 (GRCm39)	D1720V	possibly damaging	Het
Slc13a3	A	T	2: 165,250,740 (GRCm39)		probably null	Het
Slc25a40	A	T	5: 8,480,450 (GRCm39)	M67L	probably benign	Het
Slc35e1	T	C	8: 73,246,415 (GRCm39)		probably benign	Het
Spesp1	T	C	9: 62,179,924 (GRCm39)	D328G	possibly damaging	Het
Sspo	T	A	6: 48,468,389 (GRCm39)	C4363*	probably null	Het
Tbc1d8	C	T	1: 39,420,534 (GRCm39)	W666*	probably null	Het
Tubgcp2	T	C	7: 139,578,809 (GRCm39)	D721G	probably benign	Het
Vps54	CTTAAT	CT	11: 21,228,001 (GRCm39)		probably null	Het
Wsb1	T	C	11: 79,137,059 (GRCm39)	S113G	probably damaging	Het
Zfp382	T	C	7: 29,833,435 (GRCm39)	F362S	probably damaging	Het
Zfp553	G	T	7: 126,835,977 (GRCm39)	G511*	probably null	Het
Zfp568	C	T	7: 29,721,954 (GRCm39)	Q299*	probably null	Het
Zfp688	G	A	7: 127,018,397 (GRCm39)	P243S	probably damaging	Het

Other mutations in Lenep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2421:Lenep	UTSW	3	89,309,881 (GRCm39)	splice site	probably null
R8544:Lenep	UTSW	3	89,309,784 (GRCm39)	missense	possibly damaging	0.71
Z1088:Lenep	UTSW	3	89,309,876 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAGAGCAAGGTTCGTGGTTCTTTC -3'
(R):5'- AAAGGCAGTGTCCACACCCTTC -3'

Sequencing Primer
(F):5'- GTGACCCATCCTTGGTGAAG -3'
(R):5'- TGAGCTGCTGTCCACATGAG -3'

Posted On

2014-01-05