Incidental Mutation 'R1051:Rnpc3'
ID93928
Institutional Source Beutler Lab
Gene Symbol Rnpc3
Ensembl Gene ENSMUSG00000027981
Gene NameRNA-binding region (RNP1, RRM) containing 3
Synonyms
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1051 (G1)
Quality Score181
Status Not validated
Chromosome3
Chromosomal Location113605067-113630149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113629946 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 37 (E37K)
Ref Sequence ENSEMBL: ENSMUSP00000102146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092154] [ENSMUST00000106535] [ENSMUST00000106536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092154
AA Change: E37K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089792
Gene: ENSMUSG00000027981
AA Change: E37K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106535
AA Change: E37K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102145
Gene: ENSMUSG00000027981
AA Change: E37K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 4.1e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106536
AA Change: E37K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102146
Gene: ENSMUSG00000027981
AA Change: E37K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127068
Predicted Effect probably benign
Transcript: ENSMUST00000153853
SMART Domains Protein: ENSMUSP00000115492
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
Blast:RRM 2 47 8e-22 BLAST
SCOP:d1urna_ 3 53 4e-4 SMART
low complexity region 167 202 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
RRM 368 446 1.35e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195893
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo5c T A 9: 75,290,883 M1330K probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Rnpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Rnpc3 APN 3 113608399 missense probably damaging 1.00
IGL02750:Rnpc3 APN 3 113621939 missense possibly damaging 0.81
R0316:Rnpc3 UTSW 3 113629973 missense probably damaging 1.00
R0420:Rnpc3 UTSW 3 113621869 missense probably benign 0.00
R0601:Rnpc3 UTSW 3 113620106 missense probably benign 0.18
R1386:Rnpc3 UTSW 3 113613784 nonsense probably null
R1865:Rnpc3 UTSW 3 113621910 nonsense probably null
R1870:Rnpc3 UTSW 3 113611055 unclassified probably benign
R2045:Rnpc3 UTSW 3 113608360 missense possibly damaging 0.90
R4447:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4450:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4934:Rnpc3 UTSW 3 113624979 missense possibly damaging 0.86
R5436:Rnpc3 UTSW 3 113624999 missense probably damaging 1.00
R5474:Rnpc3 UTSW 3 113615509 nonsense probably null
R5498:Rnpc3 UTSW 3 113611207 critical splice donor site probably null
R5505:Rnpc3 UTSW 3 113615453 missense probably damaging 0.98
R5868:Rnpc3 UTSW 3 113616711 intron probably null
R6123:Rnpc3 UTSW 3 113609056 unclassified probably null
R7220:Rnpc3 UTSW 3 113628355 missense probably benign 0.01
R7240:Rnpc3 UTSW 3 113616831 missense probably damaging 1.00
R7507:Rnpc3 UTSW 3 113616761 missense probably benign
R7537:Rnpc3 UTSW 3 113613832 missense probably benign
R7818:Rnpc3 UTSW 3 113629951 missense probably damaging 1.00
R7872:Rnpc3 UTSW 3 113622447 nonsense probably null
R7955:Rnpc3 UTSW 3 113622447 nonsense probably null
RF023:Rnpc3 UTSW 3 113620074 missense probably damaging 0.98
X0012:Rnpc3 UTSW 3 113629909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAAGGTTCAATTCCATGCTC -3'
(R):5'- GAAACTATCTTCCGCTCAGCCTCG -3'

Sequencing Primer
(F):5'- CTCTCTGGTAGGCAAGCTG -3'
(R):5'- TCAGCCTCGGTGACTGC -3'
Posted On2014-01-05