Incidental Mutation 'R1196:Fam46c'
ID101101
Institutional Source Beutler Lab
Gene Symbol Fam46c
Ensembl Gene ENSMUSG00000044468
Gene Namefamily with sequence similarity 46, member C
Synonyms4930431B09Rik
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1196 (G1)
Quality Score212
Status Validated
Chromosome3
Chromosomal Location100451628-100489324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100473000 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 147 (T147A)
Ref Sequence ENSEMBL: ENSMUSP00000056872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061455
AA Change: T147A

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056872
Gene: ENSMUSG00000044468
AA Change: T147A

DomainStartEndE-ValueType
DUF1693 17 336 3.33e-241 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139833
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypochromic microcytic anemia and decreased B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Fam46c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fam46c APN 3 100473356 missense probably damaging 0.96
IGL01314:Fam46c APN 3 100473174 missense probably benign 0.18
IGL01409:Fam46c APN 3 100473169 missense probably damaging 1.00
IGL01817:Fam46c APN 3 100472855 missense probably damaging 1.00
IGL01863:Fam46c APN 3 100472664 missense probably benign 0.05
IGL01992:Fam46c APN 3 100472630 missense probably damaging 1.00
IGL02436:Fam46c APN 3 100472507 missense probably benign 0.43
R0111:Fam46c UTSW 3 100472786 missense probably damaging 1.00
R0529:Fam46c UTSW 3 100472370 missense probably benign 0.36
R1242:Fam46c UTSW 3 100472876 missense probably damaging 1.00
R4671:Fam46c UTSW 3 100473199 missense probably benign 0.44
R5252:Fam46c UTSW 3 100472708 missense probably damaging 1.00
R6730:Fam46c UTSW 3 100472957 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGCGATCAGCCTGTTCTGAAG -3'
(R):5'- AGGACATTGTCCAGACTGTCCGAG -3'

Sequencing Primer
(F):5'- AGATGGTCAAAGGCTTCCTC -3'
(R):5'- TGGTCAAAGACAACGGCTTG -3'
Posted On2014-01-15