Incidental Mutation 'R1367:Nek3'
ID156076
Institutional Source Beutler Lab
Gene Symbol Nek3
Ensembl Gene ENSMUSG00000031478
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 3
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22128283-22166435 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 22160361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000178324]
Predicted Effect probably benign
Transcript: ENSMUST00000033865
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110730
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178324
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Nek3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nek3 APN 8 22158706 missense probably damaging 1.00
IGL01561:Nek3 APN 8 22129456 missense probably damaging 0.97
IGL02799:Nek3 APN 8 22158719 splice site probably benign
IGL02826:Nek3 APN 8 22160368 critical splice donor site probably null
R0001:Nek3 UTSW 8 22158612 splice site probably benign
R0390:Nek3 UTSW 8 22128729 unclassified probably benign
R1565:Nek3 UTSW 8 22132201 critical splice acceptor site probably null
R1758:Nek3 UTSW 8 22160262 missense probably damaging 1.00
R1924:Nek3 UTSW 8 22157031 missense probably damaging 1.00
R3905:Nek3 UTSW 8 22133091 missense probably benign 0.01
R4078:Nek3 UTSW 8 22132137 missense probably damaging 1.00
R4089:Nek3 UTSW 8 22149913 missense probably damaging 1.00
R4621:Nek3 UTSW 8 22157039 missense probably damaging 1.00
R5207:Nek3 UTSW 8 22132227 intron probably benign
R5432:Nek3 UTSW 8 22148732 intron probably null
R5790:Nek3 UTSW 8 22131297 missense probably damaging 1.00
R5790:Nek3 UTSW 8 22131298 missense probably damaging 1.00
R6856:Nek3 UTSW 8 22129447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACAGTGAAACCAGCAGCTTC -3'
(R):5'- AAGGCACCACACCCTTTTAGCG -3'

Sequencing Primer
(F):5'- AGGCTAGTTATTGCAGACATCCG -3'
(R):5'- TTGAGCAGAAGTAGACTTACAAACC -3'
Posted On2014-02-11