Incidental Mutation 'R1331:Col14a1'
ID156217
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1331 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55410188 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 718 (W718R)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: W718R
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: W718R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: W718R
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: W718R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: W718R
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: W718R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGATGAGACACTAGCGCCTTTCC -3'
(R):5'- GGTGACACATGAACTGTGCGTGAG -3'

Sequencing Primer
(F):5'- TTCACCATCCCTATTCATTGAAACAG -3'
(R):5'- CATGAACTGTGCGTGAGAAAGC -3'
Posted On2014-02-11