Incidental Mutation 'R1375:Olfr801'
ID157479
Institutional Source Beutler Lab
Gene Symbol Olfr801
Ensembl Gene ENSMUSG00000058513
Gene Nameolfactory receptor 801
SynonymsGA_x6K02T2PULF-11349138-11348182, MOR110-10
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129666989-129673865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129670372 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 12 (L12Q)
Ref Sequence ENSEMBL: ENSMUSP00000145011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072063] [ENSMUST00000203424] [ENSMUST00000213294] [ENSMUST00000216067]
Predicted Effect probably damaging
Transcript: ENSMUST00000072063
AA Change: L49Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071941
Gene: ENSMUSG00000058513
AA Change: L49Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-51 PFAM
Pfam:7tm_1 39 288 8.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203321
Predicted Effect probably null
Transcript: ENSMUST00000203424
AA Change: L12Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145011
Gene: ENSMUSG00000058513
AA Change: L12Q

DomainStartEndE-ValueType
Pfam:7tm_4 1 96 5.9e-18 PFAM
Pfam:7tm_1 2 96 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213294
AA Change: L49Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216067
AA Change: L49Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0352 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Olfr801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr801 APN 10 129669887 missense probably damaging 1.00
IGL02400:Olfr801 APN 10 129669883 missense probably damaging 0.99
IGL02721:Olfr801 APN 10 129670123 missense probably benign 0.08
IGL03107:Olfr801 APN 10 129669940 missense probably benign 0.00
R0114:Olfr801 UTSW 10 129669598 missense probably benign
R0140:Olfr801 UTSW 10 129669688 missense probably damaging 1.00
R0652:Olfr801 UTSW 10 129670379 missense probably benign 0.08
R1449:Olfr801 UTSW 10 129670369 missense probably damaging 0.99
R2026:Olfr801 UTSW 10 129670465 missense probably damaging 1.00
R2241:Olfr801 UTSW 10 129669895 missense probably damaging 1.00
R2516:Olfr801 UTSW 10 129670286 missense probably damaging 1.00
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2873:Olfr801 UTSW 10 129669759 nonsense probably null
R6562:Olfr801 UTSW 10 129670139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGAAATCCAGTTTGAGTCCCAAC -3'
(R):5'- TGGTCATGCTTAAAATGGACCTTGCT -3'

Sequencing Primer
(F):5'- TGGCTACATATCGGTCATAGGAC -3'
(R):5'- GCTTAAAATGGACCTTGCTATGAG -3'
Posted On2014-02-18