Incidental Mutation 'R1426:Zbtb5'
ID162241
Institutional Source Beutler Lab
Gene Symbol Zbtb5
Ensembl Gene ENSMUSG00000049657
Gene Namezinc finger and BTB domain containing 5
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44991242-45012412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44993968 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 472 (H472R)
Ref Sequence ENSEMBL: ENSMUSP00000136507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045078] [ENSMUST00000055028] [ENSMUST00000107817] [ENSMUST00000131991] [ENSMUST00000151148] [ENSMUST00000180217]
Predicted Effect probably benign
Transcript: ENSMUST00000045078
SMART Domains Protein: ENSMUSP00000047218
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 327 1.4e-28 PFAM
Pfam:2-Hacid_dh_C 116 295 1.3e-59 PFAM
Pfam:NAD_binding_2 153 272 3.4e-8 PFAM
Pfam:F420_oxidored 155 244 3.2e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000055028
AA Change: H472R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059919
Gene: ENSMUSG00000049657
AA Change: H472R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107817
AA Change: H472R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103447
Gene: ENSMUSG00000049657
AA Change: H472R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131991
SMART Domains Protein: ENSMUSP00000122991
Gene: ENSMUSG00000049657

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151148
SMART Domains Protein: ENSMUSP00000120254
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 10 207 4.5e-15 PFAM
Pfam:2-Hacid_dh_C 63 222 2.2e-51 PFAM
Pfam:NAD_binding_2 100 219 3.3e-9 PFAM
Pfam:F420_oxidored 102 191 5.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180217
AA Change: H472R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136507
Gene: ENSMUSG00000049657
AA Change: H472R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Zbtb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Zbtb5 APN 4 44995294 missense probably damaging 1.00
IGL02516:Zbtb5 APN 4 44993798 missense probably damaging 0.96
IGL02525:Zbtb5 APN 4 44994731 missense probably benign
IGL03172:Zbtb5 APN 4 44994003 missense possibly damaging 0.76
IGL03205:Zbtb5 APN 4 44994949 missense probably damaging 0.96
madeleine UTSW 4 44994863 unclassified probably null
R0681:Zbtb5 UTSW 4 44993787 missense probably damaging 1.00
R1577:Zbtb5 UTSW 4 44995129 missense probably damaging 1.00
R1608:Zbtb5 UTSW 4 44993500 missense probably damaging 1.00
R1817:Zbtb5 UTSW 4 44993767 missense probably benign 0.20
R2919:Zbtb5 UTSW 4 44994790 missense probably damaging 1.00
R3722:Zbtb5 UTSW 4 44994863 unclassified probably null
R4222:Zbtb5 UTSW 4 44993855 unclassified probably null
R5217:Zbtb5 UTSW 4 44993990 missense probably benign
R5326:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5493:Zbtb5 UTSW 4 44993941 missense probably benign 0.04
R5542:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5912:Zbtb5 UTSW 4 44993750 missense probably benign 0.00
R6171:Zbtb5 UTSW 4 44994119 missense probably benign 0.00
R6337:Zbtb5 UTSW 4 44993459 missense probably damaging 1.00
R6566:Zbtb5 UTSW 4 44994508 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAAAGTTACTGGCCCCTCCTC -3'
(R):5'- GGACATCCACATCTTGGAAGTCACG -3'

Sequencing Primer
(F):5'- TGTTCTCCTTGGTAGCCTGA -3'
(R):5'- CAATTTTCTCAACAAGAGCAGGG -3'
Posted On2014-03-14