Incidental Mutation 'R1510:Triobp'
ID167882
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79003767 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1908 (R1908Q)
Ref Sequence ENSEMBL: ENSMUSP00000105311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: R567Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: R567Q

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: R1908Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: R1908Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: R1954Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: R1954Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCCCACCACATTGATAGAGCTAC -3'
(R):5'- AGGCTTTTCCAATTCCCAGCTACAC -3'

Sequencing Primer
(F):5'- GAGCTACAGTTCACAGTAGAGCC -3'
(R):5'- TTGGAATCGACCCACTGC -3'
Posted On2014-04-13