Mutagenetix > Incidental Mutation

Incidental Mutation 'R1575:Cdk4'

171115

Institutional Source

Beutler Lab

Gene Symbol

Cdk4

Ensembl Gene

ENSMUSG00000006728

Gene Name

cyclin dependent kinase 4

Synonyms

Crk3, p34/cdk4

MMRRC Submission

039613-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R1575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126899404-126903157 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126900520 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 95 (H95Q)

Ref Sequence

ENSEMBL: ENSMUSP00000117234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]

AlphaFold

P30285

Predicted Effect

probably damaging
Transcript: ENSMUST00000006911
AA Change: H95Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: H95Q

Domain	Start	End	E-Value	Type
S_TKc	6	295	9.2e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040307

SMART Domains

Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

Domain	Start	End	E-Value	Type
low complexity region	20	45	N/A	INTRINSIC
low complexity region	50	60	N/A	INTRINSIC
low complexity region	76	105	N/A	INTRINSIC
RINGv	109	156	7.51e-18	SMART
transmembrane domain	183	205	N/A	INTRINSIC
Blast:AAA	211	238	2e-9	BLAST
low complexity region	267	284	N/A	INTRINSIC
low complexity region	291	302	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000060991

SMART Domains

Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	8	200	1.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120226

SMART Domains

Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

Domain	Start	End	E-Value	Type
Pfam:Pkinase	6	103	6e-10	PFAM
low complexity region	121	138	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123456

Predicted Effect

probably damaging
Transcript: ENSMUST00000125682
AA Change: H95Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: H95Q

Domain	Start	End	E-Value	Type
S_TKc	6	261	5.19e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133115
AA Change: H95Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: H95Q

Domain	Start	End	E-Value	Type
S_TKc	6	250	1.55e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145670

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218488

Predicted Effect

probably benign
Transcript: ENSMUST00000142558

SMART Domains

Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

Domain	Start	End	E-Value	Type
Pfam:Pkinase	6	74	1.6e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220344

Meta Mutation Damage Score

0.7464

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	A	3: 148,558,398 (GRCm39)	T437S	probably benign	Het
Akna	A	G	4: 63,297,570 (GRCm39)	F828S	probably benign	Het
Alg9	G	T	9: 50,686,802 (GRCm39)	A40S	possibly damaging	Het
Alox8	T	A	11: 69,076,067 (GRCm39)	H628L	possibly damaging	Het
Aox3	T	C	1: 58,191,713 (GRCm39)	W422R	probably benign	Het
Atp13a4	T	C	16: 29,228,528 (GRCm39)	D984G	probably benign	Het
Bcam	T	C	7: 19,494,307 (GRCm39)	E363G	possibly damaging	Het
Cadps2	C	A	6: 23,429,217 (GRCm39)	V519F	probably damaging	Het
Calca	A	G	7: 114,234,396 (GRCm39)	Y18H	probably damaging	Het
Cd70	A	G	17: 57,453,364 (GRCm39)	I100T	probably damaging	Het
Chchd1	T	A	14: 20,753,410 (GRCm39)	N11K	probably damaging	Het
Cma2	T	A	14: 56,210,272 (GRCm39)	N52K	probably damaging	Het
Cyp3a16	A	G	5: 145,373,267 (GRCm39)	V500A	probably benign	Het
Dicer1	A	G	12: 104,688,228 (GRCm39)		probably null	Het
Dnajc13	A	G	9: 104,034,037 (GRCm39)	S2206P	probably benign	Het
Dtl	T	C	1: 191,293,658 (GRCm39)		probably null	Het
Fam186b	T	C	15: 99,184,852 (GRCm39)	T24A	probably benign	Het
Fbxw21	A	G	9: 108,990,984 (GRCm39)	V25A	probably benign	Het
Gins1	T	C	2: 150,754,758 (GRCm39)	S45P	probably benign	Het
Gtpbp2	T	A	17: 46,476,869 (GRCm39)	V349D	probably damaging	Het
Hyal5	G	T	6: 24,876,792 (GRCm39)	D222Y	probably damaging	Het
Itgal	A	G	7: 126,900,060 (GRCm39)		probably null	Het
Klk14	A	G	7: 43,343,377 (GRCm39)		probably null	Het
Lama1	T	A	17: 68,117,404 (GRCm39)	L2518Q	possibly damaging	Het
Lrrc2	G	A	9: 110,808,555 (GRCm39)	G264D	probably benign	Het
Ltbp4	A	G	7: 27,022,245 (GRCm39)	S893P	probably damaging	Het
Mast4	G	A	13: 102,875,771 (GRCm39)	P1107L	probably damaging	Het
Mbd1	T	A	18: 74,408,490 (GRCm39)		probably null	Het
Naip2	A	T	13: 100,291,529 (GRCm39)	D1136E	probably benign	Het
Naip2	G	A	13: 100,291,537 (GRCm39)		probably benign	Het
Ncan	G	A	8: 70,562,848 (GRCm39)	T470I	probably benign	Het
Npy1r	A	T	8: 67,156,813 (GRCm39)	I78F	probably damaging	Het
Or10q1b	A	T	19: 13,682,889 (GRCm39)	M233L	probably benign	Het
Or8b52	G	A	9: 38,576,573 (GRCm39)	T189M	probably damaging	Het
Palb2	A	T	7: 121,710,061 (GRCm39)		probably null	Het
Pax3	T	C	1: 78,080,121 (GRCm39)	T422A	probably benign	Het
Pebp1	A	T	5: 117,424,229 (GRCm39)	D72E	possibly damaging	Het
Pnliprp1	A	T	19: 58,728,901 (GRCm39)	T363S	probably benign	Het
Rbm44	G	A	1: 91,084,565 (GRCm39)		probably null	Het
Rbm47	T	A	5: 66,182,358 (GRCm39)	Y425F	probably benign	Het
Robo3	G	T	9: 37,340,957 (GRCm39)	A83E	probably damaging	Het
Rrm1	A	G	7: 102,105,721 (GRCm39)	Y279C	probably damaging	Het
Rslcan18	A	T	13: 67,256,121 (GRCm39)		probably benign	Het
Scara5	C	A	14: 65,968,314 (GRCm39)	Q196K	probably benign	Het
Setd1b	C	T	5: 123,301,210 (GRCm39)		probably benign	Het
Siah1a	A	G	8: 87,451,869 (GRCm39)	F205S	probably damaging	Het
Smr2	AT	ATT	5: 88,256,683 (GRCm39)		probably null	Het
Ssu72	A	G	4: 155,815,814 (GRCm39)	D86G	probably benign	Het
St7	G	T	6: 17,886,110 (GRCm39)	K357N	probably damaging	Het
Sv2b	G	A	7: 74,797,425 (GRCm39)	T323I	probably damaging	Het
Syt1	T	C	10: 108,340,361 (GRCm39)	N319S	probably benign	Het
Tanc1	T	A	2: 59,621,995 (GRCm39)	F371L	probably damaging	Het
Tcf20	C	A	15: 82,739,693 (GRCm39)	G586V	probably benign	Het
Tg	T	C	15: 66,601,534 (GRCm39)		probably null	Het
Tyk2	A	T	9: 21,026,758 (GRCm39)	N620K	probably benign	Het
Ube2j1	T	A	4: 33,045,116 (GRCm39)	S130T	probably benign	Het
Ubr2	G	T	17: 47,243,418 (GRCm39)	P1696H	probably damaging	Het
Ubr5	A	T	15: 38,041,085 (GRCm39)	D266E	probably damaging	Het
Vipr2	A	G	12: 116,107,892 (GRCm39)	T426A	probably benign	Het
Vmn2r104	A	T	17: 20,262,477 (GRCm39)	W218R	probably damaging	Het
Vmn2r83	T	A	10: 79,314,956 (GRCm39)	N401K	probably damaging	Het
Vwf	A	G	6: 125,632,214 (GRCm39)	E82G	unknown	Het
Vwf	T	A	6: 125,640,534 (GRCm39)	Y2323*	probably null	Het
Wdr76	T	G	2: 121,359,402 (GRCm39)	V329G	probably damaging	Het
Zan	A	G	5: 137,460,214 (GRCm39)	C1226R	unknown	Het
Zbtb16	G	T	9: 48,743,572 (GRCm39)	Q247K	probably damaging	Het
Zfp541	T	C	7: 15,812,640 (GRCm39)	V431A	possibly damaging	Het

Other mutations in Cdk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Cdk4	APN	10	126,900,166 (GRCm39)	missense	probably damaging	1.00
IGL01326:Cdk4	APN	10	126,900,492 (GRCm39)	missense	possibly damaging	0.95
R0140:Cdk4	UTSW	10	126,900,214 (GRCm39)	missense	probably damaging	1.00
R0799:Cdk4	UTSW	10	126,900,863 (GRCm39)	missense	probably damaging	0.98
R1437:Cdk4	UTSW	10	126,900,558 (GRCm39)	missense	probably damaging	1.00
R1656:Cdk4	UTSW	10	126,900,849 (GRCm39)	missense	probably benign	0.00
R1761:Cdk4	UTSW	10	126,900,546 (GRCm39)	unclassified	probably benign
R2567:Cdk4	UTSW	10	126,900,145 (GRCm39)	missense	probably benign	0.01
R4679:Cdk4	UTSW	10	126,900,780 (GRCm39)	missense	possibly damaging	0.93
R4790:Cdk4	UTSW	10	126,900,570 (GRCm39)	missense	probably damaging	1.00
R4897:Cdk4	UTSW	10	126,900,444 (GRCm39)	intron	probably benign
R4946:Cdk4	UTSW	10	126,900,759 (GRCm39)	splice site	probably null
R5755:Cdk4	UTSW	10	126,900,591 (GRCm39)	critical splice donor site	probably null
R6515:Cdk4	UTSW	10	126,902,052 (GRCm39)	missense	probably null	0.06
R6868:Cdk4	UTSW	10	126,900,870 (GRCm39)	missense	probably benign	0.43
R7488:Cdk4	UTSW	10	126,900,106 (GRCm39)	start codon destroyed	probably null	0.26
R7748:Cdk4	UTSW	10	126,900,298 (GRCm39)	missense	possibly damaging	0.78
R8956:Cdk4	UTSW	10	126,900,546 (GRCm39)	unclassified	probably benign
R9082:Cdk4	UTSW	10	126,900,732 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGAGTTCCTAATGGAGGAGCAGC -3'
(R):5'- TTCAGGTCCCGGTGAACAATGCAG -3'

Sequencing Primer
(F):5'- GGCCTTTGAACATCCCAATG -3'
(R):5'- GAAACTGACGCATTAGATCCTG -3'

Posted On

2014-04-13