Incidental Mutation 'R1575:Cdk4'
ID171115
Institutional Source Beutler Lab
Gene Symbol Cdk4
Ensembl Gene ENSMUSG00000006728
Gene Namecyclin-dependent kinase 4
SynonymsCrk3, p34/cdk4
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127063534-127067920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127064651 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 95 (H95Q)
Ref Sequence ENSEMBL: ENSMUSP00000117234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably damaging
Transcript: ENSMUST00000006911
AA Change: H95Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: H95Q

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040307
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060991
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably damaging
Transcript: ENSMUST00000125682
AA Change: H95Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: H95Q

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133115
AA Change: H95Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: H95Q

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Cdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Cdk4 APN 10 127064297 missense probably damaging 1.00
IGL01326:Cdk4 APN 10 127064623 missense possibly damaging 0.95
R0140:Cdk4 UTSW 10 127064345 missense probably damaging 1.00
R0799:Cdk4 UTSW 10 127064994 missense probably damaging 0.98
R1437:Cdk4 UTSW 10 127064689 missense probably damaging 1.00
R1656:Cdk4 UTSW 10 127064980 missense probably benign 0.00
R1761:Cdk4 UTSW 10 127064677 unclassified probably null
R2567:Cdk4 UTSW 10 127064276 missense probably benign 0.01
R4679:Cdk4 UTSW 10 127064911 missense possibly damaging 0.93
R4790:Cdk4 UTSW 10 127064701 missense probably damaging 1.00
R4897:Cdk4 UTSW 10 127064575 intron probably benign
R4946:Cdk4 UTSW 10 127064890 unclassified probably null
R5755:Cdk4 UTSW 10 127064722 critical splice donor site probably null
R6515:Cdk4 UTSW 10 127066183 missense probably null 0.06
R6868:Cdk4 UTSW 10 127065001 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGAGAGTTCCTAATGGAGGAGCAGC -3'
(R):5'- TTCAGGTCCCGGTGAACAATGCAG -3'

Sequencing Primer
(F):5'- GGCCTTTGAACATCCCAATG -3'
(R):5'- GAAACTGACGCATTAGATCCTG -3'
Posted On2014-04-13