Incidental Mutation 'R1621:Pou2af1'
ID174665
Institutional Source Beutler Lab
Gene Symbol Pou2af1
Ensembl Gene ENSMUSG00000032053
Gene NamePOU domain, class 2, associating factor 1
SynonymsOCA-B, OCAB, OBF-1, OBF.1, BOB.1, Bob1, Bob-1
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R1621 (G1)
Quality Score211
Status Not validated
Chromosome9
Chromosomal Location51213708-51240080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51232860 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 54 (H54Y)
Ref Sequence ENSEMBL: ENSMUSP00000034554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034554]
Predicted Effect probably damaging
Transcript: ENSMUST00000034554
AA Change: H54Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034554
Gene: ENSMUSG00000032053
AA Change: H54Y

DomainStartEndE-ValueType
Pfam:PD-C2-AF1 7 255 4.8e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214322
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of mature B cells, absence of germinal centers, and low serum levels of non-IgM immunoglobulins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Pou2af1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Pou2af1 UTSW 9 51233208 missense probably benign 0.21
R4609:Pou2af1 UTSW 9 51238225 missense possibly damaging 0.84
R4757:Pou2af1 UTSW 9 51233139 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCAGGGAGCCAATTGTACACATCC -3'
(R):5'- GCAGAAACCTCCATGTCAAGGCAG -3'

Sequencing Primer
(F):5'- GAGCCAATTGTACACATCCTAGTG -3'
(R):5'- CTCCATGTCAAGGCAGGAAGG -3'
Posted On2014-04-24