Incidental Mutation 'R1621:Slc25a48'
ID174678
Institutional Source Beutler Lab
Gene Symbol Slc25a48
Ensembl Gene ENSMUSG00000021509
Gene Namesolute carrier family 25, member 48
Synonyms
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location56438355-56474239 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 56470470 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 307 (*307R)
Ref Sequence ENSEMBL: ENSMUSP00000021971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021971]
Predicted Effect probably null
Transcript: ENSMUST00000021971
AA Change: *307R
SMART Domains Protein: ENSMUSP00000021971
Gene: ENSMUSG00000021509
AA Change: *307R

DomainStartEndE-ValueType
Pfam:Mito_carr 3 91 5.3e-20 PFAM
Pfam:Mito_carr 101 204 3.3e-17 PFAM
Pfam:Mito_carr 208 301 1.3e-23 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Slc25a48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Slc25a48 APN 13 56464945 splice site probably benign
IGL01746:Slc25a48 APN 13 56470353 missense probably damaging 0.99
IGL03209:Slc25a48 APN 13 56470459 missense probably benign 0.00
R0068:Slc25a48 UTSW 13 56451211 missense probably damaging 1.00
R0068:Slc25a48 UTSW 13 56451211 missense probably damaging 1.00
R0550:Slc25a48 UTSW 13 56448998 missense probably benign 0.03
R1397:Slc25a48 UTSW 13 56465051 missense probably damaging 0.98
R1426:Slc25a48 UTSW 13 56448991 splice site probably benign
R1937:Slc25a48 UTSW 13 56448998 missense probably damaging 0.99
R4710:Slc25a48 UTSW 13 56463566 missense probably damaging 0.97
R4735:Slc25a48 UTSW 13 56449074 splice site probably null
R6107:Slc25a48 UTSW 13 56465078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAACCTGCTAGGGTCTTTCCAC -3'
(R):5'- CCAGCCACGGCTACTTCAGAATTG -3'

Sequencing Primer
(F):5'- TGGGCTACCTTGCAGTCAC -3'
(R):5'- TTGCAATGTGATGGTGAGAAG -3'
Posted On2014-04-24