Incidental Mutation 'R1611:Klhl5'
ID176792
Institutional Source Beutler Lab
Gene Symbol Klhl5
Ensembl Gene ENSMUSG00000054920
Gene Namekelch-like 5
Synonyms
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65107539-65168188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65164649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 673 (T673A)
Ref Sequence ENSEMBL: ENSMUSP00000098752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000203538] [ENSMUST00000204097] [ENSMUST00000204348]
Predicted Effect probably benign
Transcript: ENSMUST00000101191
AA Change: T673A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920
AA Change: T673A

DomainStartEndE-ValueType
low complexity region 114 137 N/A INTRINSIC
BTB 173 270 1.5e-28 SMART
BACK 275 376 7.85e-36 SMART
Kelch 421 467 1.12e-11 SMART
Kelch 468 514 3.2e-16 SMART
Kelch 515 561 1.51e-12 SMART
Kelch 562 608 4.6e-17 SMART
Kelch 609 661 2.84e-8 SMART
Kelch 662 708 1.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203538
SMART Domains Protein: ENSMUSP00000145269
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
Kelch 46 92 3.7e-14 SMART
Kelch 93 139 1.1e-18 SMART
Kelch 140 186 5.1e-15 SMART
Kelch 187 233 1.5e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204097
AA Change: T533A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920
AA Change: T533A

DomainStartEndE-ValueType
BTB 33 130 1.5e-28 SMART
BACK 135 236 7.85e-36 SMART
Kelch 281 327 1.12e-11 SMART
Kelch 328 374 3.2e-16 SMART
Kelch 375 421 1.51e-12 SMART
Kelch 422 468 4.6e-17 SMART
Kelch 469 521 2.84e-8 SMART
Kelch 522 568 1.83e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000204348
AA Change: T612A
SMART Domains Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920
AA Change: T612A

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Klhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Klhl5 APN 5 65148800 missense probably damaging 0.98
IGL02700:Klhl5 APN 5 65131430 nonsense probably null
R0064:Klhl5 UTSW 5 65141288 missense probably benign 0.13
R0142:Klhl5 UTSW 5 65143350 nonsense probably null
R0783:Klhl5 UTSW 5 65156253 splice site probably benign
R0828:Klhl5 UTSW 5 65162792 missense probably damaging 1.00
R1160:Klhl5 UTSW 5 65141340 missense probably benign 0.13
R1181:Klhl5 UTSW 5 65162885 missense probably damaging 0.99
R1903:Klhl5 UTSW 5 65166987 missense probably benign 0.37
R4880:Klhl5 UTSW 5 65158901 missense probably damaging 1.00
R4961:Klhl5 UTSW 5 65152690 intron probably benign
R5204:Klhl5 UTSW 5 65131438 missense possibly damaging 0.95
R5389:Klhl5 UTSW 5 65141282 missense possibly damaging 0.76
R5921:Klhl5 UTSW 5 65162956 missense probably damaging 0.96
R6769:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R6771:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
X0009:Klhl5 UTSW 5 65162921 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGTGGACACTGAAGCCTTGACAG -3'
(R):5'- ACGTTTGTGTGATGCCCACCAG -3'

Sequencing Primer
(F):5'- TGAGACTGAGGCTAGACTTGC -3'
(R):5'- GTGTTGGGTAAAGCTGAGAGC -3'
Posted On2014-04-24