Incidental Mutation 'R1611:Pias3'
ID176777
Institutional Source Beutler Lab
Gene Symbol Pias3
Ensembl Gene ENSMUSG00000028101
Gene Nameprotein inhibitor of activated STAT 3
SynonymsPias3L
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R1611 (G1)
Quality Score185
Status Validated
Chromosome3
Chromosomal Location96696384-96706070 bp(+) (GRCm38)
Type of Mutationunclassified (5 bp from exon)
DNA Base Change (assembly) T to A at 96699697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000176302]
Predicted Effect probably damaging
Transcript: ENSMUST00000064900
AA Change: L101Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: L101Q

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107076
AA Change: L92Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: L92Q

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107077
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161296
Predicted Effect probably null
Transcript: ENSMUST00000162156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162707
Predicted Effect probably null
Transcript: ENSMUST00000162778
SMART Domains Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162934
AA Change: L92Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: L92Q

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176288
Predicted Effect probably benign
Transcript: ENSMUST00000176302
SMART Domains Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 2.57e-3 SMART
Meta Mutation Damage Score 0.634 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Pias3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Pias3 APN 3 96699422 splice site probably benign
IGL01370:Pias3 APN 3 96703575 missense probably damaging 0.96
IGL01806:Pias3 APN 3 96703757 missense probably benign 0.02
IGL02533:Pias3 APN 3 96699616 missense possibly damaging 0.71
IGL02998:Pias3 APN 3 96702179 missense probably damaging 0.98
IGL03304:Pias3 APN 3 96700031 missense possibly damaging 0.65
R0764:Pias3 UTSW 3 96701295 missense probably damaging 1.00
R1697:Pias3 UTSW 3 96702225 missense probably damaging 1.00
R1751:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R1767:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R2184:Pias3 UTSW 3 96702221 missense possibly damaging 0.92
R2257:Pias3 UTSW 3 96699646 missense probably benign 0.22
R2398:Pias3 UTSW 3 96703813 missense probably benign 0.00
R2851:Pias3 UTSW 3 96703537 missense possibly damaging 0.94
R3845:Pias3 UTSW 3 96702210 missense probably benign 0.28
R4127:Pias3 UTSW 3 96699666 missense probably damaging 0.97
R4500:Pias3 UTSW 3 96701418 missense probably damaging 1.00
R4628:Pias3 UTSW 3 96699820 missense probably damaging 1.00
R5068:Pias3 UTSW 3 96703855 missense probably damaging 0.98
R5108:Pias3 UTSW 3 96704937 missense possibly damaging 0.88
R5477:Pias3 UTSW 3 96705003 missense probably damaging 0.99
R5498:Pias3 UTSW 3 96702188 missense possibly damaging 0.89
R6457:Pias3 UTSW 3 96699523 missense possibly damaging 0.81
R6966:Pias3 UTSW 3 96702195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACATGGTGATGAGTTTCCGAG -3'
(R):5'- AGGGAGCATAGTCAGCCATACCAAG -3'

Sequencing Primer
(F):5'- CTTCGCTGGCAGGAACAAG -3'
(R):5'- CATACCAAGGGTGGTGGGTC -3'
Posted On2014-04-24