Incidental Mutation 'R1611:Ddb1'
ID176833
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10612888 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 260 (C260S)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably damaging
Transcript: ENSMUST00000025649
AA Change: C260S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: C260S

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGAGCTACACCTTGAGTTCTG -3'
(R):5'- GGAACCACACATTTGGGCTAAGCAC -3'

Sequencing Primer
(F):5'- GAAACTTATCTTCAAAGGCTGCCTG -3'
(R):5'- TTCCACTCGAAGGTCCTTGAG -3'
Posted On2014-04-24