Incidental Mutation 'R1570:Chd9'
ID177187
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 039609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1570 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91036542 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 2332 (M2332L)
Ref Sequence ENSEMBL: ENSMUSP00000148088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423]
Predicted Effect probably benign
Transcript: ENSMUST00000048665
AA Change: M2332L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: M2332L

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109614
AA Change: M2332L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: M2332L

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
Predicted Effect probably benign
Transcript: ENSMUST00000209423
AA Change: M2332L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency 93% (77/83)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec1 A G 6: 122,591,085 probably null Het
Arhgap21 G T 2: 20,880,840 Q348K probably benign Het
Arl5c A G 11: 97,992,387 V129A probably benign Het
Armh1 A G 4: 117,229,992 S159P probably damaging Het
Asb8 A G 15: 98,136,428 L82P probably damaging Het
Bahcc1 G A 11: 120,272,183 A436T possibly damaging Het
Btc T C 5: 91,402,717 D2G unknown Het
C1s2 G A 6: 124,625,764 T490M probably benign Het
Caap1 C T 4: 94,556,577 G43D probably benign Het
Ccr5 T C 9: 124,124,963 V201A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdhr5 C A 7: 141,271,769 G541C probably damaging Het
Cep170 A G 1: 176,755,801 I1004T possibly damaging Het
Clk1 T A 1: 58,414,425 H334L probably benign Het
Cyp4b1 G A 4: 115,635,963 S228F probably benign Het
Dnah9 T C 11: 66,112,330 N883D probably benign Het
Dync2h1 A G 9: 7,176,926 L11P probably benign Het
Ephx4 A G 5: 107,419,851 E225G probably damaging Het
Erich6 C T 3: 58,630,659 probably null Het
Espl1 A G 15: 102,298,367 T89A probably damaging Het
Evi2 T A 11: 79,516,250 K166N possibly damaging Het
Glrx5 A G 12: 105,032,868 T57A possibly damaging Het
Gm15448 T C 7: 3,823,061 E311G probably benign Het
Gm884 A G 11: 103,609,938 Y597H possibly damaging Het
Gnptab T A 10: 88,419,454 V222E probably damaging Het
Gpr155 T C 2: 73,370,038 Y375C possibly damaging Het
Hsd11b1 C G 1: 193,240,327 E141Q probably damaging Het
Ildr2 T C 1: 166,303,585 F337L probably damaging Het
Ino80 C T 2: 119,447,028 R322Q possibly damaging Het
Lcp2 A G 11: 34,089,601 D467G probably benign Het
Lmbr1 A G 5: 29,254,558 I229T probably damaging Het
Lnpep A T 17: 17,579,156 M79K probably damaging Het
Lpin1 T C 12: 16,560,998 Q564R possibly damaging Het
Lpin2 T A 17: 71,245,181 L794* probably null Het
Lrrc45 T C 11: 120,720,109 probably null Het
Mtus1 A G 8: 41,076,241 S751P probably damaging Het
Nbr1 T C 11: 101,564,830 probably benign Het
Nup107 A G 10: 117,763,844 F592S possibly damaging Het
Nup133 T A 8: 123,949,176 M1L possibly damaging Het
Olfr1104 A T 2: 87,022,272 S91T probably benign Het
Olfr1208 A C 2: 88,896,946 I217S probably damaging Het
Olfr139 A C 11: 74,044,807 F156V possibly damaging Het
Olfr434 T C 6: 43,217,351 V146A probably benign Het
Olfr548-ps1 C A 7: 102,541,970 H11Q probably damaging Het
Olfr732 T G 14: 50,281,524 H243P probably damaging Het
Otud7b T C 3: 96,155,891 C816R probably damaging Het
Pi4k2a T C 19: 42,100,644 V148A probably benign Het
Pih1d2 T C 9: 50,621,179 M195T probably benign Het
Plpp6 T C 19: 28,964,778 F260L probably damaging Het
R3hcc1l A T 19: 42,581,954 T663S probably damaging Het
Rnf25 T C 1: 74,595,267 E199G probably damaging Het
Scin G A 12: 40,084,381 probably benign Het
Serpinb1c A T 13: 32,896,990 S37T probably benign Het
Snx19 A G 9: 30,428,343 D259G probably damaging Het
Sorcs3 A G 19: 48,764,181 K805R probably damaging Het
Sox6 C A 7: 115,777,123 G125W probably damaging Het
Spink5 A G 18: 43,967,107 I64V probably benign Het
St6galnac1 A G 11: 116,766,648 probably benign Het
Sult1c2 T C 17: 53,836,963 I105V probably benign Het
Tacr3 T G 3: 134,829,756 S162A probably damaging Het
Tex43 T A 18: 56,594,534 D101E probably benign Het
Ttc6 T C 12: 57,674,763 S1013P probably damaging Het
Zbtb11 C A 16: 55,990,815 N445K probably benign Het
Zfp423 A C 8: 87,782,558 V261G probably benign Het
Zfp59 T C 7: 27,853,591 V156A probably benign Het
Zscan2 C A 7: 80,863,393 A42E probably damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
hovel UTSW 8 91015204 missense probably benign 0.19
shack UTSW 8 90932798 missense probably damaging 1.00
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1624:Chd9 UTSW 8 90998535 missense probably benign 0.17
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4125:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4628:Chd9 UTSW 8 90983463 missense probably benign 0.05
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91015249 missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5088:Chd9 UTSW 8 90977519 missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
R7043:Chd9 UTSW 8 91034215 utr 3 prime probably benign
R7094:Chd9 UTSW 8 90989561 missense unknown
R7126:Chd9 UTSW 8 91015225 missense unknown
R7182:Chd9 UTSW 8 91006622 missense unknown
R7219:Chd9 UTSW 8 91001766 missense unknown
R7260:Chd9 UTSW 8 90994543 missense unknown
R7293:Chd9 UTSW 8 91034079 missense unknown
R7303:Chd9 UTSW 8 91051904 missense unknown
R7358:Chd9 UTSW 8 90983487 missense unknown
R7358:Chd9 UTSW 8 91034218 missense unknown
R7451:Chd9 UTSW 8 91033790 frame shift probably null
R7451:Chd9 UTSW 8 91033818 missense probably benign 0.27
R7456:Chd9 UTSW 8 90932525 nonsense probably null
R7481:Chd9 UTSW 8 90956438 missense unknown
R7532:Chd9 UTSW 8 90994565 missense unknown
R7570:Chd9 UTSW 8 90994580 missense unknown
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGCAAAGGTCTGGCCTAAG -3'
(R):5'- GCAGTACCCTGAGACAAGGATGTG -3'

Sequencing Primer
(F):5'- AACCGCCTGGACAGTATTTG -3'
(R):5'- gaaggaagggaggaaggaag -3'
Posted On2014-04-24