Incidental Mutation 'R1663:Enam'
ID186919
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88503994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1046 (S1046C)
Ref Sequence ENSEMBL: ENSMUSP00000031222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably damaging
Transcript: ENSMUST00000031222
AA Change: S1046C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: S1046C

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199104
AA Change: S1121C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: S1121C

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
X0018:Enam UTSW 5 88502691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGACTTCCTGCCTCAAAGTTACCC -3'
(R):5'- GGAGTAAGGCCAGCAGTTCTTTCAC -3'

Sequencing Primer
(F):5'- GTTACCCAACAGGTCAAAATGAAG -3'
(R):5'- CTCCAAGGTCACTTTTAAGACAGG -3'
Posted On2014-05-09