Incidental Mutation 'R4910:Enam'
ID379377
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 042512-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R4910 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88502314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 561 (S561A)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: S486A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: S486A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199104
AA Change: S561A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: S561A

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.6%
  • 20x: 86.1%
Validation Efficiency 95% (144/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,998,199 T3016K probably damaging Het
Adam3 T A 8: 24,694,305 I560L probably benign Het
Agxt T C 1: 93,135,714 F113L probably benign Het
Aknad1 T A 3: 108,781,252 probably null Het
Alpk2 T A 18: 65,266,286 K2074* probably null Het
Apob A G 12: 8,007,848 Y2077C probably damaging Het
Arhgap17 A T 7: 123,308,377 L254Q probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Arid1b T A 17: 5,342,203 S2003T probably damaging Het
Armc5 T G 7: 128,240,728 L406R possibly damaging Het
Arsb T C 13: 93,771,977 V67A probably benign Het
Aspm A G 1: 139,491,543 Y2982C probably damaging Het
Btbd7 A G 12: 102,808,048 L487P probably damaging Het
Card11 C G 5: 140,874,414 D1063H probably damaging Het
Ccdc186 G A 19: 56,798,691 T615M probably damaging Het
Cd101 T A 3: 100,993,889 T960S probably benign Het
Cdca7l C A 12: 117,873,785 S191* probably null Het
Cemip A T 7: 83,997,411 I143N probably damaging Het
Cep170 C T 1: 176,782,263 E161K possibly damaging Het
Chrm2 A T 6: 36,524,233 T342S probably benign Het
Cib2 A G 9: 54,549,879 F34L probably benign Het
Cnot1 A T 8: 95,733,231 I1836N probably benign Het
Col4a3 C A 1: 82,672,679 P552Q unknown Het
Cp T A 3: 19,989,224 probably benign Het
Cul3 C T 1: 80,290,089 V112I probably benign Het
Dcdc5 A G 2: 106,365,550 noncoding transcript Het
Disp1 A T 1: 183,135,463 V133E probably damaging Het
Dlg4 A G 11: 70,030,925 D30G probably damaging Het
Dopey1 C T 9: 86,492,061 T191I probably damaging Het
Fbxw8 G T 5: 118,125,027 probably null Het
Filip1 A G 9: 79,817,932 V1135A probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Ghdc T C 11: 100,766,988 K472E probably benign Het
Gm10568 T G 1: 3,680,941 noncoding transcript Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gm6871 T A 7: 41,573,592 H24L probably benign Het
Gm8298 T A 3: 59,869,014 probably null Het
Gpr155 G A 2: 73,367,538 Q413* probably null Het
Grhl2 A G 15: 37,291,676 probably null Het
Ighv1-31 G C 12: 114,829,508 S36* probably null Het
Ighv8-5 A G 12: 115,067,842 S26P probably damaging Het
Igkv17-134 A C 6: 67,720,926 probably benign Het
Igkv5-48 A C 6: 69,726,849 L24R probably damaging Het
Isg20l2 T A 3: 87,939,263 V340E probably damaging Het
Lrrtm1 A G 6: 77,244,901 Y447C probably damaging Het
Ltbp1 T C 17: 75,327,292 S855P probably damaging Het
Mgat4e A T 1: 134,541,864 N147K probably damaging Het
Mlc1 A G 15: 88,958,212 L315P possibly damaging Het
Mrgpra2a A G 7: 47,426,544 V322A probably benign Het
Mroh7 T C 4: 106,709,955 probably null Het
Mybpc1 T A 10: 88,555,724 K304* probably null Het
Nlrp14 A C 7: 107,186,583 D622A possibly damaging Het
Nlrp1b T A 11: 71,217,277 H466L probably benign Het
Nlrp4d T A 7: 10,378,409 noncoding transcript Het
Nrxn3 A G 12: 89,260,360 E628G possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Nup98 A G 7: 102,195,800 S21P unknown Het
Olfr1307 A T 2: 111,945,078 I126K possibly damaging Het
Olfr168 T C 16: 19,530,018 T301A probably benign Het
Olfr173 T A 16: 58,797,442 T135S probably benign Het
Olfr251 T A 9: 38,378,742 V287E probably null Het
Olfr671 G A 7: 104,975,479 P169S possibly damaging Het
Olfr753-ps1 T C 17: 37,170,043 I202V probably benign Het
Olfr798 T C 10: 129,625,807 T85A probably damaging Het
Otog A T 7: 46,264,062 Y773F probably damaging Het
Otog A T 7: 46,298,534 I2320F probably damaging Het
Otogl T C 10: 107,879,517 S433G probably benign Het
Pcdhb17 A T 18: 37,485,159 M1L possibly damaging Het
Pde7b T A 10: 20,724,734 probably benign Het
Pgm2 T C 4: 99,963,527 V207A probably damaging Het
Pkd1 T A 17: 24,572,687 V1116E probably damaging Het
Pkd1l1 T A 11: 8,929,360 Y497F possibly damaging Het
Pomgnt2 T C 9: 121,982,947 N256S probably benign Het
Pot1a A T 6: 25,746,021 probably benign Het
Prdm9 T C 17: 15,544,323 T732A probably benign Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptpro T C 6: 137,368,338 V114A probably damaging Het
Pyurf A G 6: 57,691,948 S20P unknown Het
Rasgrf1 A G 9: 89,976,752 T488A probably benign Het
Rassf8 A T 6: 145,815,280 K111* probably null Het
Reps1 A T 10: 18,107,688 E426D probably damaging Het
Robo2 T C 16: 73,933,778 K982R probably damaging Het
Rps23 T C 13: 90,923,752 probably null Het
Scamp4 T A 10: 80,609,671 V56E probably damaging Het
Serpina1c C T 12: 103,895,032 V408I probably benign Het
Sigirr A G 7: 141,093,788 W49R probably damaging Het
Slc17a6 A T 7: 51,658,741 H271L possibly damaging Het
Slc7a5 G T 8: 121,885,122 T389K probably damaging Het
Slf1 T A 13: 77,043,880 H945L probably benign Het
Slit3 T C 11: 35,632,722 S662P probably damaging Het
Snta1 C A 2: 154,377,018 E466* probably null Het
Sowaha A G 11: 53,478,445 L488P probably damaging Het
Spata17 C A 1: 187,194,011 V41F probably damaging Het
Spta1 T A 1: 174,217,863 probably null Het
Srrm2 T A 17: 23,815,388 probably benign Het
Stard13 T C 5: 151,062,527 N388S probably benign Het
Stmn3 T C 2: 181,308,837 K59E probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Svep1 T C 4: 58,096,276 H1448R possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tbkbp1 G A 11: 97,139,130 S400L probably benign Het
Tesc G T 5: 118,056,466 probably benign Het
Tjp1 C T 7: 65,343,727 G33R probably damaging Het
Tlr11 C A 14: 50,362,889 F777L probably benign Het
Tmem156 A G 5: 65,091,462 probably benign Het
Top3a A G 11: 60,752,378 probably benign Het
Tpcn1 A G 5: 120,556,519 W162R probably damaging Het
Tpd52l2 A T 2: 181,515,212 probably benign Het
Trim80 G A 11: 115,446,455 G381D probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Vmn2r56 T A 7: 12,715,535 I259F possibly damaging Het
Vmn2r59 T C 7: 42,043,653 T508A probably benign Het
Wdr73 A G 7: 80,891,708 V362A probably damaging Het
Zdhhc21 G T 4: 82,820,331 T207K possibly damaging Het
Zfp120 T A 2: 150,117,952 Q150L probably damaging Het
Zfp212 C A 6: 47,931,499 Q471K possibly damaging Het
Zfp804b C T 5: 6,770,540 G841D possibly damaging Het
Znfx1 A T 2: 167,036,804 M1884K probably damaging Het
Znfx1 G T 2: 167,037,482 A1658D probably benign Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
X0018:Enam UTSW 5 88502691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGCCTCAAATAAACCCTTTG -3'
(R):5'- AGGCCTGATTGCTTCTCATAAATG -3'

Sequencing Primer
(F):5'- TCCGGCCTCAAACAAACC -3'
(R):5'- CTCATAAATGGTTTATTTGAGGCCTG -3'
Posted On2016-04-15