Incidental Mutation 'R1799:N4bp2'
ID202921
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene NameNEDD4 binding protein 2
SynonymsB3bp, LOC333789, LOC386488
MMRRC Submission 039829-MU
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65763521-65830108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65806825 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 739 (N739S)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087264
AA Change: N739S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: N739S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113738
AA Change: N739S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109367
Gene: ENSMUSG00000037795
AA Change: N739S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200843
Predicted Effect possibly damaging
Transcript: ENSMUST00000201489
AA Change: N739S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: N739S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201615
AA Change: N739S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: N739S

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202411
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65790960 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 unclassified probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1735:N4bp2 UTSW 5 65808316 missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1846:N4bp2 UTSW 5 65808519 missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5731:N4bp2 UTSW 5 65809157 missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65806846 missense not run
R7112:N4bp2 UTSW 5 65790707 missense not run
Predicted Primers PCR Primer
(F):5'- TCAAGAAGCCTGTGGGTCTG -3'
(R):5'- GTCGCTCACAGCACTAAGTG -3'

Sequencing Primer
(F):5'- TCGCCTCCTGAAATGCTGGAAG -3'
(R):5'- CAGCACTAAGTGAGCTTTGC -3'
Posted On2014-06-23