Incidental Mutation 'R0285:Vmn2r82'
ID24683
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission 038506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0285 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79396557 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 797 (W797R)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect probably damaging
Transcript: ENSMUST00000170596
AA Change: W797R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: W797R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,533,865 G5S probably damaging Het
Acy3 A G 19: 3,988,193 E162G probably benign Het
Angptl1 T C 1: 156,845,215 S204P probably benign Het
Atf6b C T 17: 34,650,396 probably benign Het
Card11 G A 5: 140,887,101 S619F probably damaging Het
Ccl11 G A 11: 82,062,258 V81I probably damaging Het
Cds1 T C 5: 101,797,038 I126T probably damaging Het
Chd1 A G 17: 17,374,680 probably benign Het
Cndp1 C A 18: 84,618,238 V384F possibly damaging Het
Cuta A G 17: 26,939,449 probably null Het
Diaph3 G A 14: 87,115,024 T47I possibly damaging Het
Dopey1 A T 9: 86,512,639 S598C probably damaging Het
Dsp A G 13: 38,172,794 M217V probably benign Het
Esyt1 T A 10: 128,512,218 I898F possibly damaging Het
Fam189a2 G A 19: 23,979,385 probably benign Het
Fam205a1 G A 4: 42,850,236 T640M probably benign Het
Fam84b T C 15: 60,822,967 H310R probably benign Het
Fgd3 A T 13: 49,263,948 W680R possibly damaging Het
Folh1 A G 7: 86,742,165 probably benign Het
Fuk G C 8: 110,893,717 H235Q probably benign Het
Gadl1 C A 9: 116,030,738 probably benign Het
Garem1 A G 18: 21,129,612 M715T probably benign Het
Gpd2 A T 2: 57,338,955 D257V probably benign Het
Hdac7 A G 15: 97,798,222 probably null Het
Heatr5b A G 17: 78,808,453 M858T probably benign Het
Inpp4b A T 8: 82,034,516 probably benign Het
Iqgap3 G T 3: 88,096,990 C461F probably benign Het
Lamb1 C A 12: 31,326,645 C559* probably null Het
Lrrc31 T C 3: 30,684,948 N308S probably benign Het
Ly75 T C 2: 60,318,319 Y1222C probably damaging Het
Map3k10 C A 7: 27,673,900 R42L probably benign Het
Meioc A G 11: 102,672,191 T72A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp11 T C 10: 75,925,668 Y366C probably damaging Het
N4bp2 T A 5: 65,806,559 D650E probably benign Het
Ncoa6 T C 2: 155,415,701 M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nol4l G A 2: 153,483,853 probably benign Het
Notch1 T G 2: 26,460,861 D2089A possibly damaging Het
Olfr1156 A G 2: 87,950,131 I34T probably damaging Het
Olfr1419 A G 19: 11,871,138 L26P probably damaging Het
Olfr1449 A T 19: 12,935,172 M145L probably benign Het
Olfr155 G A 4: 43,854,398 V30M possibly damaging Het
Olfr493 A G 7: 108,346,499 S161P probably benign Het
Olfr649 A T 7: 104,189,324 Y294* probably null Het
Olfr930 T A 9: 38,930,774 I201N possibly damaging Het
Otof C T 5: 30,379,533 probably null Het
Paox T C 7: 140,129,140 F324L probably damaging Het
Pycr1 A T 11: 120,640,316 I277N probably benign Het
R3hcc1l A T 19: 42,576,129 H627L probably damaging Het
Rab21 G A 10: 115,290,863 S193L probably benign Het
Ralgds T G 2: 28,550,569 probably null Het
Rbm42 A G 7: 30,645,840 S169P possibly damaging Het
Rfpl4 A G 7: 5,110,378 V262A probably benign Het
Rhobtb3 A G 13: 75,877,509 I496T possibly damaging Het
Rnf31 G A 14: 55,601,389 A901T probably damaging Het
Ryr2 T C 13: 11,716,977 D2359G probably damaging Het
Sgo2b A C 8: 63,928,789 Y336* probably null Het
Slc16a7 T A 10: 125,294,631 I62L probably benign Het
Slc22a21 A T 11: 53,959,196 probably benign Het
Slc25a21 A G 12: 56,858,025 probably null Het
Slc5a4b T C 10: 76,062,283 I532M probably damaging Het
Srrm4 C A 5: 116,467,789 probably benign Het
Stxbp1 C A 2: 32,823,542 E27D probably benign Het
Sult2a5 T A 7: 13,628,760 Y131N probably damaging Het
Svopl T C 6: 37,984,522 Q492R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Tmprss11c A G 5: 86,271,430 L90P probably damaging Het
Tmprss6 T A 15: 78,452,868 D346V probably damaging Het
Ubr4 A C 4: 139,440,801 S2820R probably damaging Het
Usp4 T C 9: 108,378,564 V607A probably benign Het
Usp45 A G 4: 21,798,603 probably null Het
Vill C T 9: 119,070,827 probably benign Het
Vmn1r13 C A 6: 57,209,994 T46N probably benign Het
Vmn2r107 A G 17: 20,345,611 T63A probably benign Het
Washc2 T A 6: 116,221,839 D287E probably damaging Het
Xpc G A 6: 91,498,064 L660F probably damaging Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79378800 missense possibly damaging 0.46
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79379419 missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79379037 missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79396008 missense possibly damaging 0.82
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGTGTTAGCCAAAACCATCACTG -3'
(R):5'- GTGTTCAACTCTGGCCTAAACAAAACG -3'

Sequencing Primer
(F):5'- GTATATGGCTGGGAACATCTCCTC -3'
(R):5'- TCTGGCCTAAACAAAACGATGTAG -3'
Posted On2013-04-16