Incidental Mutation 'R2909:Il12a'
ID 261127
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Name interleukin 12a
Synonyms p35, IL-12p35
MMRRC Submission 040496-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2909 (G1)
Quality Score 217
Status Not validated
Chromosome 3
Chromosomal Location 68597977-68605880 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TCAC to TC at 68605320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
AlphaFold P43431
Predicted Effect probably null
Transcript: ENSMUST00000029345
AA Change: 216
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: 216

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107816
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195517
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 G A 2: 158,467,140 (GRCm39) G27R possibly damaging Het
Bltp1 A G 3: 37,002,102 (GRCm39) D1349G probably damaging Het
Chrm3 G T 13: 9,928,033 (GRCm39) D334E probably benign Het
Clic5 A C 17: 44,586,146 (GRCm39) T212P probably benign Het
Dapk1 G A 13: 60,864,631 (GRCm39) probably null Het
Dync2h1 A T 9: 7,049,114 (GRCm39) L3262H probably damaging Het
Epg5 G C 18: 78,026,691 (GRCm39) W1227C probably damaging Het
Fancm T C 12: 65,171,630 (GRCm39) S1757P probably damaging Het
Gm3604 G C 13: 62,516,832 (GRCm39) H509D probably benign Het
Gramd4 G T 15: 86,006,384 (GRCm39) E163* probably null Het
Hip1r T A 5: 124,138,656 (GRCm39) probably null Het
Ice1 G T 13: 70,744,292 (GRCm39) T2097K probably damaging Het
Kbtbd7 A G 14: 79,665,922 (GRCm39) T585A probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnq3 T C 15: 65,897,085 (GRCm39) T272A possibly damaging Het
Ly6l T G 15: 75,321,481 (GRCm39) probably null Het
Minar1 T C 9: 89,473,331 (GRCm39) N860S probably damaging Het
Mrps11 C A 7: 78,438,497 (GRCm39) A83E probably damaging Het
Or1af1 C T 2: 37,110,188 (GRCm39) P229L probably damaging Het
Pax7 T C 4: 139,556,007 (GRCm39) I156V possibly damaging Het
Plbd1 A T 6: 136,611,572 (GRCm39) V235D probably damaging Het
Pml T C 9: 58,154,526 (GRCm39) S76G possibly damaging Het
Ppp1r42 T A 1: 10,073,637 (GRCm39) probably benign Het
Rsl24d1 T C 9: 73,029,585 (GRCm39) L61S probably damaging Het
Rtp2 T C 16: 23,746,235 (GRCm39) E132G probably damaging Het
Sgk1 A G 10: 21,870,715 (GRCm39) I23V probably benign Het
Sharpin A G 15: 76,234,811 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,404,105 (GRCm39) Y533N probably benign Het
Slc12a9 T C 5: 137,330,463 (GRCm39) I81V probably benign Het
Stxbp5l G A 16: 37,028,548 (GRCm39) T505M possibly damaging Het
Tmem40 A G 6: 115,713,342 (GRCm39) probably null Het
Tnfrsf18 A T 4: 156,112,727 (GRCm39) N138Y probably damaging Het
Vmn2r87 A T 10: 130,314,865 (GRCm39) N240K probably damaging Het
Vmn2r91 A G 17: 18,356,661 (GRCm39) E776G probably damaging Het
Vmn2r92 T A 17: 18,405,377 (GRCm39) N840K possibly damaging Het
Vmn2r98 T C 17: 19,287,664 (GRCm39) I499T probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68,598,888 (GRCm39) missense possibly damaging 0.96
IGL01820:Il12a APN 3 68,599,495 (GRCm39) splice site probably benign
IGL01989:Il12a APN 3 68,598,909 (GRCm39) splice site probably benign
bakers_dozen UTSW 3 68,605,320 (GRCm39) frame shift probably null
R0388:Il12a UTSW 3 68,602,520 (GRCm39) splice site probably null
R0646:Il12a UTSW 3 68,605,223 (GRCm39) splice site probably benign
R1083:Il12a UTSW 3 68,602,666 (GRCm39) missense probably damaging 1.00
R1588:Il12a UTSW 3 68,602,896 (GRCm39) missense probably benign 0.04
R2240:Il12a UTSW 3 68,601,517 (GRCm39) nonsense probably null
R2925:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3696:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3697:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3698:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R4332:Il12a UTSW 3 68,602,594 (GRCm39) intron probably benign
R5809:Il12a UTSW 3 68,602,595 (GRCm39) intron probably benign
R6279:Il12a UTSW 3 68,605,312 (GRCm39) missense probably damaging 0.96
R6305:Il12a UTSW 3 68,601,511 (GRCm39) missense possibly damaging 0.80
R6847:Il12a UTSW 3 68,602,899 (GRCm39) missense probably damaging 1.00
R7751:Il12a UTSW 3 68,605,235 (GRCm39) missense probably damaging 1.00
R8188:Il12a UTSW 3 68,598,872 (GRCm39) missense unknown
R8339:Il12a UTSW 3 68,599,438 (GRCm39) nonsense probably null
R9145:Il12a UTSW 3 68,598,875 (GRCm39) missense unknown
RF003:Il12a UTSW 3 68,602,562 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTTTGCATTGACTGTCTCC -3'
(R):5'- AGGTAGCTGTGCCACCTTTG -3'

Sequencing Primer
(F):5'- GACTGTCTCCCATTTTGCAGACAAAC -3'
(R):5'- CCACCTTTGGGGAGATGAG -3'
Posted On 2015-01-23