Incidental Mutation 'R2909:Sipa1l1'
ID261148
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82357331 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 533 (Y533N)
Ref Sequence ENSEMBL: ENSMUSP00000152681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect probably benign
Transcript: ENSMUST00000053969
AA Change: Y533N

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: Y533N

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166429
AA Change: Y533N

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: Y533N

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220766
Predicted Effect probably benign
Transcript: ENSMUST00000220963
AA Change: Y533N

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222298
AA Change: Y533N

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222714
AA Change: Y533N

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R0980:Sipa1l1 UTSW 12 82342220 missense possibly damaging 0.60
R1051:Sipa1l1 UTSW 12 82449345 missense possibly damaging 0.48
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R4012:Sipa1l1 UTSW 12 82341782 missense possibly damaging 0.86
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4651:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATCTTGAACCCGAAGAG -3'
(R):5'- AAGAACAGATCCCTCTTCCGAG -3'

Sequencing Primer
(F):5'- TGATCTTGAACCCGAAGAGAATATG -3'
(R):5'- TCTAGCTAGAATGCTCCAGGGATC -3'
Posted On2015-01-23