Incidental Mutation 'R2909:Hip1r'
ID261131
Institutional Source Beutler Lab
Gene Symbol Hip1r
Ensembl Gene ENSMUSG00000000915
Gene Namehuntingtin interacting protein 1 related
Synonyms
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123973628-124005558 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 124000593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000939] [ENSMUST00000040967]
Predicted Effect probably null
Transcript: ENSMUST00000000939
SMART Domains Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
ENTH 29 151 5.27e-40 SMART
low complexity region 301 321 N/A INTRINSIC
PDB:3I00|B 340 458 1e-21 PDB
Pfam:HIP1_clath_bdg 461 559 1.1e-34 PFAM
low complexity region 627 633 N/A INTRINSIC
ILWEQ 814 1012 9.19e-121 SMART
low complexity region 1016 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040967
SMART Domains Protein: ENSMUSP00000047980
Gene: ENSMUSG00000066278

DomainStartEndE-ValueType
Pfam:Mod_r 11 156 3.9e-40 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166258
SMART Domains Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
Pfam:ANTH 1 79 3.5e-19 PFAM
low complexity region 80 100 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192309
Predicted Effect probably benign
Transcript: ENSMUST00000198664
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Hip1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hip1r APN 5 123989735 critical splice donor site probably null
IGL01771:Hip1r APN 5 123999543 missense possibly damaging 0.95
IGL01804:Hip1r APN 5 124001550 critical splice donor site probably null
IGL02100:Hip1r APN 5 123998943 unclassified probably benign
IGL02139:Hip1r APN 5 123996244 missense probably damaging 1.00
IGL02321:Hip1r APN 5 123999890 missense probably damaging 0.99
IGL02562:Hip1r APN 5 123991523 unclassified probably benign
IGL02745:Hip1r APN 5 123990939 splice site probably null
IGL02798:Hip1r APN 5 123994712 unclassified probably benign
IGL03365:Hip1r APN 5 124000167 missense probably damaging 1.00
R0172:Hip1r UTSW 5 123996940 missense possibly damaging 0.47
R0546:Hip1r UTSW 5 123999051 missense possibly damaging 0.89
R0799:Hip1r UTSW 5 123996941 missense probably benign 0.00
R1588:Hip1r UTSW 5 123996575 missense probably damaging 0.98
R1590:Hip1r UTSW 5 124002140 missense probably benign 0.00
R1675:Hip1r UTSW 5 123994820 missense probably damaging 1.00
R1801:Hip1r UTSW 5 123998808 missense probably benign
R1818:Hip1r UTSW 5 123995955 critical splice donor site probably null
R1852:Hip1r UTSW 5 123991505 missense probably benign 0.10
R1936:Hip1r UTSW 5 123996071 missense probably damaging 1.00
R1954:Hip1r UTSW 5 124001844 missense probably damaging 0.96
R1989:Hip1r UTSW 5 123989698 missense probably damaging 1.00
R2045:Hip1r UTSW 5 124000731 missense probably benign
R2105:Hip1r UTSW 5 124000204 missense probably damaging 0.96
R2414:Hip1r UTSW 5 124001243 missense probably damaging 1.00
R3125:Hip1r UTSW 5 124000141 missense probably benign 0.20
R3401:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3402:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3889:Hip1r UTSW 5 124001791 nonsense probably null
R4212:Hip1r UTSW 5 123999890 missense probably benign 0.06
R4421:Hip1r UTSW 5 123997862 missense possibly damaging 0.66
R4422:Hip1r UTSW 5 123997006 missense possibly damaging 0.93
R4713:Hip1r UTSW 5 123989980 missense probably benign 0.02
R6837:Hip1r UTSW 5 123998865 missense possibly damaging 0.63
R7171:Hip1r UTSW 5 123995944 missense probably benign 0.02
R7251:Hip1r UTSW 5 123994750 missense probably damaging 1.00
R7319:Hip1r UTSW 5 123999111 missense probably damaging 1.00
Z1088:Hip1r UTSW 5 123999132 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGGTACAGGACATGATGAGCC -3'
(R):5'- AATTTCCTTCTGCAGGCTGG -3'

Sequencing Primer
(F):5'- TGAGAGGTGAGCACGACTTCC -3'
(R):5'- TGGTGGAGGTCATCACCAG -3'
Posted On2015-01-23