Incidental Mutation 'ANU22:Tmem168'
ID262580
Institutional Source Beutler Lab
Gene Symbol Tmem168
Ensembl Gene ENSMUSG00000029569
Gene Nametransmembrane protein 168
Synonyms5730526F17Rik, 8430437G11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #ANU22
Quality Score184
Status Not validated
Chromosome6
Chromosomal Location13580687-13608100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13583046 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 612 (V612E)
Ref Sequence ENSEMBL: ENSMUSP00000031554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031554] [ENSMUST00000149123]
Predicted Effect probably damaging
Transcript: ENSMUST00000031554
AA Change: V612E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031554
Gene: ENSMUSG00000029569
AA Change: V612E

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 109 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 199 216 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
transmembrane domain 298 320 N/A INTRINSIC
transmembrane domain 359 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149123
AA Change: V228E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145372
Gene: ENSMUSG00000029569
AA Change: V228E

DomainStartEndE-ValueType
SCOP:d1jxqa_ 29 167 8e-3 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Tmem168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Tmem168 APN 6 13602675 missense probably benign 0.06
IGL01305:Tmem168 APN 6 13583046 missense probably damaging 1.00
IGL01843:Tmem168 APN 6 13582941 missense probably damaging 1.00
IGL02742:Tmem168 APN 6 13603262 missense probably benign 0.04
IGL02863:Tmem168 APN 6 13582918 missense probably damaging 0.98
R0193:Tmem168 UTSW 6 13583313 missense possibly damaging 0.81
R0537:Tmem168 UTSW 6 13603361 missense probably damaging 1.00
R0630:Tmem168 UTSW 6 13583065 missense probably benign
R0890:Tmem168 UTSW 6 13603272 missense probably damaging 1.00
R1416:Tmem168 UTSW 6 13591401 missense probably damaging 0.96
R1900:Tmem168 UTSW 6 13583071 missense probably benign 0.02
R3947:Tmem168 UTSW 6 13583052 missense probably damaging 1.00
R4362:Tmem168 UTSW 6 13595073 missense probably benign 0.31
R4620:Tmem168 UTSW 6 13594953 missense probably benign 0.03
R5693:Tmem168 UTSW 6 13602321 missense probably benign 0.01
R6142:Tmem168 UTSW 6 13591369 missense probably benign
R6328:Tmem168 UTSW 6 13602711 missense probably benign
R6438:Tmem168 UTSW 6 13602674 missense probably benign 0.06
R6711:Tmem168 UTSW 6 13603121 missense probably damaging 1.00
R6827:Tmem168 UTSW 6 13582838 missense probably damaging 0.99
R6987:Tmem168 UTSW 6 13591477 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGTCCTGTGTCCAGC -3'
(R):5'- GAGAAGAACGGTTCCTTCTGTTCCC -3'

Sequencing Primer
(F):5'- CTGTGTCCAGCACTGTAGGAAG -3'
(R):5'- GGCTTATCATCATCTTAGACAGCG -3'
Posted On2015-02-04