Mutagenetix > Incidental Mutation

Incidental Mutation 'R3622:Rps18'

268689

Institutional Source

Beutler Lab

Gene Symbol

Rps18

Ensembl Gene

ENSMUSG00000008668

Gene Name

ribosomal protein S18

Synonyms

H-2Ke3, H2-Ke3

MMRRC Submission

040677-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34170972-34174639 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

G to C at 34171247 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000173196] [ENSMUST00000174609]

AlphaFold

P62270

Predicted Effect

probably benign
Transcript: ENSMUST00000008812
AA Change: L111V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668
AA Change: L111V

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S13	14	142	2.2e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000025170

SMART Domains

Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

Domain	Start	End	E-Value	Type
coiled coil region	126	155	N/A	INTRINSIC
low complexity region	204	217	N/A	INTRINSIC
WD40	225	262	1.02e2	SMART
WD40	267	302	3.3e1	SMART
Blast:WD40	305	344	8e-19	BLAST
WD40	347	386	9.52e-6	SMART
Blast:WD40	392	426	3e-14	BLAST
BING4CT	439	517	8.85e-53	SMART
low complexity region	542	556	N/A	INTRINSIC
low complexity region	586	593	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000025178

SMART Domains

Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
low complexity region	24	45	N/A	INTRINSIC
Pfam:Sec3_C	79	244	4.6e-13	PFAM
Pfam:Vps52	94	601	5.1e-233	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000087543

SMART Domains

Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
Pfam:Galactosyl_T	85	302	1.3e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172550

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172799

Predicted Effect

probably null
Transcript: ENSMUST00000173196

SMART Domains

Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319

Domain	Start	End	E-Value	Type
low complexity region	18	39	N/A	INTRINSIC
Pfam:Vps52	88	120	2.7e-6	PFAM
Pfam:Vps52	116	527	3e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174620

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174175

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174745

Predicted Effect

silent
Transcript: ENSMUST00000174609

SMART Domains

Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S13	14	107	2.1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174758

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174662

Meta Mutation Damage Score

0.3783

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S13P family of ribosomal proteins. It is located in the cytoplasm. The gene product of the E. coli ortholog (ribosomal protein S13) is involved in the binding of fMet-tRNA, and thus, in the initiation of translation. This gene is an ortholog of mouse Ke3. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 119,950,036 (GRCm39)	Y503*	probably null	Het
Akap9	C	A	5: 4,026,235 (GRCm39)	Q1297K	possibly damaging	Het
Dffb	T	C	4: 154,049,976 (GRCm39)	T296A	probably damaging	Het
Dpf1	G	A	7: 29,015,631 (GRCm39)		probably null	Het
Elp1	A	T	4: 56,759,925 (GRCm39)		probably null	Het
Grid2ip	T	C	5: 143,371,774 (GRCm39)	S666P	probably damaging	Het
Gucy2e	T	A	11: 69,115,877 (GRCm39)	E835V	probably damaging	Het
Hdac5	G	A	11: 102,086,644 (GRCm39)	P120S	probably benign	Het
Htr1d	T	C	4: 136,170,815 (GRCm39)	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,737 (GRCm39)	S364C	probably damaging	Het
Igkv1-133	A	T	6: 67,701,944 (GRCm39)	Q16L	probably benign	Het
Itga10	C	T	3: 96,559,054 (GRCm39)		probably benign	Het
Met	A	T	6: 17,549,085 (GRCm39)	D979V	probably damaging	Het
Mga	A	G	2: 119,772,245 (GRCm39)	T1702A	probably damaging	Het
Midn	A	G	10: 79,986,144 (GRCm39)	D78G	probably benign	Het
Muc5b	T	C	7: 141,405,595 (GRCm39)		probably benign	Het
Oma1	T	C	4: 103,223,288 (GRCm39)	I491T	probably benign	Het
Or1e30	A	G	11: 73,678,567 (GRCm39)	T268A	probably benign	Het
Or5ak24	C	T	2: 85,260,837 (GRCm39)	C112Y	probably benign	Het
Or5b107	T	A	19: 13,143,020 (GRCm39)	M214K	probably benign	Het
Or8b48	A	G	9: 38,492,792 (GRCm39)	Y73C	probably damaging	Het
Pbld2	T	C	10: 62,897,470 (GRCm39)	L57P	probably damaging	Het
Phka2	T	A	X: 159,327,291 (GRCm39)	Y334*	probably null	Het
Plin4	G	T	17: 56,411,112 (GRCm39)	T973K	possibly damaging	Het
R3hdm4	C	T	10: 79,748,515 (GRCm39)	R143H	possibly damaging	Het
Samd9l	A	T	6: 3,374,032 (GRCm39)	C1076*	probably null	Het
Scml4	T	C	10: 42,806,607 (GRCm39)		probably benign	Het
Slc16a10	A	G	10: 40,017,890 (GRCm39)	V48A	probably benign	Het
Slc6a5	T	C	7: 49,567,371 (GRCm39)	V275A	probably benign	Het
Smad9	C	T	3: 54,696,705 (GRCm39)	R257W	probably damaging	Het
Snrpb	C	A	2: 130,017,299 (GRCm39)	R73L	probably null	Het
Srsf9	C	T	5: 115,468,571 (GRCm39)	A69V	probably damaging	Het
Stfa2	A	G	16: 36,224,433 (GRCm39)	Y90H	probably damaging	Het
Tgm6	T	A	2: 129,993,681 (GRCm39)	V640E	possibly damaging	Het
Tnrc6c	C	T	11: 117,640,451 (GRCm39)	R1414C	probably damaging	Het
Tyk2	A	T	9: 21,038,606 (GRCm39)	C8S	probably damaging	Het
Upp2	G	A	2: 58,680,128 (GRCm39)	R300Q	possibly damaging	Het
Utp20	A	G	10: 88,593,855 (GRCm39)		probably benign	Het
Veph1	C	T	3: 66,122,858 (GRCm39)	V224I	probably benign	Het
Vmn1r30	A	T	6: 58,412,437 (GRCm39)	F132I	probably benign	Het
Vmn2r116	A	G	17: 23,605,025 (GRCm39)	S113G	probably benign	Het
Vps53	A	C	11: 76,008,609 (GRCm39)	V237G	probably benign	Het

Other mutations in Rps18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02216:Rps18	APN	17	34,171,015 (GRCm39)	utr 3 prime	probably benign
R1658:Rps18	UTSW	17	34,171,392 (GRCm39)	missense	probably benign	0.03
R5008:Rps18	UTSW	17	34,171,258 (GRCm39)	splice site	probably null
R6220:Rps18	UTSW	17	34,174,110 (GRCm39)	missense	probably damaging	0.97
R8110:Rps18	UTSW	17	34,174,110 (GRCm39)	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TGGATACACCCACAGTTCGG -3'
(R):5'- CAGACTGGTTCCTGAACAGAC -3'

Sequencing Primer
(F):5'- CTTGGTGTGCTGACCGC -3'
(R):5'- CTGGTTCCTGAACAGACAGAAG -3'

Posted On

2015-02-19