Incidental Mutation 'R3625:Hist1h2bg'
ID269386
Institutional Source Beutler Lab
Gene Symbol Hist1h2bg
Ensembl Gene ENSMUSG00000058385
Gene Namehistone cluster 1, H2bg
Synonyms
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3625 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23571396-23572013 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23571451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]
Predicted Effect unknown
Transcript: ENSMUST00000079251
AA Change: S7P
SMART Domains Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385
AA Change: S7P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090776
SMART Domains Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102969
SMART Domains Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105106
SMART Domains Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200671
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Hist1h2bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Hist1h2bg APN 13 23571435 start codon destroyed probably null
IGL02256:Hist1h2bg APN 13 23571435 start codon destroyed probably null
IGL02258:Hist1h2bg APN 13 23571435 start codon destroyed probably null
PIT4508001:Hist1h2bg UTSW 13 23571693 unclassified probably benign
R7295:Hist1h2bg UTSW 13 23571769 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TATCTTTCCTCTGCAGCCAATAAGG -3'
(R):5'- CACGAACGAGTTCATGATGCC -3'

Sequencing Primer
(F):5'- TTCCTCTGCAGCCAATAAGGAAAGAG -3'
(R):5'- CCATGGCCTTGGAGGAGATG -3'
Posted On2015-02-19