Incidental Mutation 'R3500:Tas2r122'
ID273762
Institutional Source Beutler Lab
Gene Symbol Tas2r122
Ensembl Gene ENSMUSG00000078280
Gene Nametaste receptor, type 2, member 122
SynonymsTas2r22, T2R22, mGR22
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132710999-132711928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132711560 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 123 (K123N)
Ref Sequence ENSEMBL: ENSMUSP00000100699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105077]
Predicted Effect probably damaging
Transcript: ENSMUST00000105077
AA Change: K123N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100699
Gene: ENSMUSG00000078280
AA Change: K123N

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-73 PFAM
Meta Mutation Damage Score 0.0344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Tas2r122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tas2r122 APN 6 132711762 missense possibly damaging 0.87
IGL02478:Tas2r122 APN 6 132711615 missense possibly damaging 0.81
IGL02605:Tas2r122 APN 6 132711609 missense probably damaging 0.99
IGL02646:Tas2r122 APN 6 132711790 missense probably damaging 1.00
IGL02716:Tas2r122 APN 6 132711264 missense probably damaging 1.00
R0318:Tas2r122 UTSW 6 132711832 missense possibly damaging 0.90
R0462:Tas2r122 UTSW 6 132711178 missense probably benign 0.06
R0532:Tas2r122 UTSW 6 132711828 missense possibly damaging 0.94
R0538:Tas2r122 UTSW 6 132711815 missense probably benign 0.06
R0570:Tas2r122 UTSW 6 132711811 missense probably damaging 1.00
R1863:Tas2r122 UTSW 6 132711102 nonsense probably null
R1966:Tas2r122 UTSW 6 132711194 nonsense probably null
R2001:Tas2r122 UTSW 6 132711622 missense possibly damaging 0.91
R3871:Tas2r122 UTSW 6 132711580 missense probably benign 0.00
R4174:Tas2r122 UTSW 6 132711876 missense probably damaging 0.96
R5533:Tas2r122 UTSW 6 132711430 missense probably damaging 1.00
R5567:Tas2r122 UTSW 6 132711372 missense probably benign 0.28
R6455:Tas2r122 UTSW 6 132711663 nonsense probably null
R6716:Tas2r122 UTSW 6 132711897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTATGGTAGACTAAGAAACCAC -3'
(R):5'- GGTTGGCCATCTCCAGAATG -3'

Sequencing Primer
(F):5'- ACCACTTAGAGTATCTAAAACAGGG -3'
(R):5'- CCAGAATGTGTGTTCTATGGACAAC -3'
Posted On2015-04-02