Incidental Mutation 'R3807:Rgs11'
ID274997
Institutional Source Beutler Lab
Gene Symbol Rgs11
Ensembl Gene ENSMUSG00000024186
Gene Nameregulator of G-protein signaling 11
Synonyms
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26202951-26211324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26203500 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 69 (I69F)
Ref Sequence ENSEMBL: ENSMUSP00000025020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000039113] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025020
AA Change: I69F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186
AA Change: I69F

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039113
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120333
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122058
AA Change: I67F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186
AA Change: I67F

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect probably benign
Transcript: ENSMUST00000142410
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Rgs11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Rgs11 APN 17 26207397 missense probably damaging 1.00
IGL01617:Rgs11 APN 17 26208250 missense probably damaging 1.00
IGL02150:Rgs11 APN 17 26202994 missense probably benign 0.05
IGL02610:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02612:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02617:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02669:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02670:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02674:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02706:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02707:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02741:Rgs11 APN 17 26207631 missense probably benign 0.31
R0147:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0148:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0508:Rgs11 UTSW 17 26207469 splice site probably benign
R0744:Rgs11 UTSW 17 26203318 missense probably damaging 1.00
R1479:Rgs11 UTSW 17 26208283 unclassified probably null
R1599:Rgs11 UTSW 17 26208249 missense probably damaging 1.00
R1779:Rgs11 UTSW 17 26210666 missense probably damaging 1.00
R3692:Rgs11 UTSW 17 26204328 unclassified probably benign
R3889:Rgs11 UTSW 17 26207587 missense probably damaging 0.98
R4689:Rgs11 UTSW 17 26204547 critical splice donor site probably null
R4832:Rgs11 UTSW 17 26207568 missense probably benign 0.00
R5052:Rgs11 UTSW 17 26207973 intron probably benign
R5330:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5331:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5683:Rgs11 UTSW 17 26205181 missense probably benign 0.32
R5879:Rgs11 UTSW 17 26203463 unclassified probably benign
R6156:Rgs11 UTSW 17 26210465 nonsense probably null
R6671:Rgs11 UTSW 17 26208298 missense probably damaging 1.00
R7432:Rgs11 UTSW 17 26207760 missense probably damaging 0.99
Z1088:Rgs11 UTSW 17 26205772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGACCAAGGCGTGAAGATG -3'
(R):5'- GTAAGCTCCACCCTCCCTAAGTAG -3'

Sequencing Primer
(F):5'- CAAGGCGTGAAGATGCGGAG -3'
(R):5'- TGACCTGGAACCTGTAGGG -3'
Posted On2015-04-02