Incidental Mutation 'R3837:Tdp1'
ID275709
Institutional Source Beutler Lab
Gene Symbol Tdp1
Ensembl Gene ENSMUSG00000021177
Gene Nametyrosyl-DNA phosphodiesterase 1
SynonymsE430034L06Rik, 2810481F14Rik, SCAN1, 4921509N21Rik
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location99884517-99955219 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 99894708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021594] [ENSMUST00000137653] [ENSMUST00000153627]
Predicted Effect probably null
Transcript: ENSMUST00000021594
SMART Domains Protein: ENSMUSP00000021594
Gene: ENSMUSG00000021177

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 164 583 2.7e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137653
SMART Domains Protein: ENSMUSP00000123269
Gene: ENSMUSG00000021177

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151019
Predicted Effect probably null
Transcript: ENSMUST00000153627
SMART Domains Protein: ENSMUSP00000118656
Gene: ENSMUSG00000021177

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 166 583 2.4e-142 PFAM
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit defective single strand DNA repair in neurons, decreased cerebellum size and increased sensitivity to topotecan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Tdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Tdp1 APN 12 99893648 missense possibly damaging 0.79
IGL01099:Tdp1 APN 12 99915445 splice site probably benign
IGL01295:Tdp1 APN 12 99891670 missense probably benign 0.00
IGL01409:Tdp1 APN 12 99909681 missense possibly damaging 0.83
IGL01482:Tdp1 APN 12 99891380 missense probably benign
IGL03116:Tdp1 APN 12 99955031 missense probably benign 0.27
R0008:Tdp1 UTSW 12 99954958 splice site probably benign
R0033:Tdp1 UTSW 12 99935052 missense probably benign 0.30
R0092:Tdp1 UTSW 12 99954989 missense probably damaging 1.00
R0485:Tdp1 UTSW 12 99909842 missense probably benign 0.30
R0611:Tdp1 UTSW 12 99909711 missense probably benign
R0853:Tdp1 UTSW 12 99935067 missense probably damaging 0.96
R1539:Tdp1 UTSW 12 99912312 missense probably damaging 1.00
R1692:Tdp1 UTSW 12 99955001 missense probably damaging 1.00
R1751:Tdp1 UTSW 12 99891343 unclassified probably null
R1767:Tdp1 UTSW 12 99891343 unclassified probably null
R3788:Tdp1 UTSW 12 99891752 splice site probably benign
R3790:Tdp1 UTSW 12 99891752 splice site probably benign
R3917:Tdp1 UTSW 12 99894717 missense probably damaging 1.00
R4209:Tdp1 UTSW 12 99898329 missense probably damaging 1.00
R4211:Tdp1 UTSW 12 99898329 missense probably damaging 1.00
R4509:Tdp1 UTSW 12 99955065 utr 3 prime probably benign
R4774:Tdp1 UTSW 12 99902364 missense possibly damaging 0.56
R4859:Tdp1 UTSW 12 99909811 missense probably benign 0.20
R5229:Tdp1 UTSW 12 99893660 missense probably damaging 1.00
R5348:Tdp1 UTSW 12 99915506 missense probably damaging 1.00
R5441:Tdp1 UTSW 12 99910285 missense probably damaging 1.00
R5457:Tdp1 UTSW 12 99894746 nonsense probably null
R5685:Tdp1 UTSW 12 99902352 missense possibly damaging 0.51
R6329:Tdp1 UTSW 12 99914071 missense probably damaging 0.99
R6329:Tdp1 UTSW 12 99914072 missense probably benign 0.02
R7060:Tdp1 UTSW 12 99911688 missense probably benign 0.02
R7066:Tdp1 UTSW 12 99894732 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACGTTAGGGAAACTTTGTAATCCTG -3'
(R):5'- TGCTTACAATGATGTCAAGCG -3'

Sequencing Primer
(F):5'- CCTTAGAACCTCTTTGGGAATCTGG -3'
(R):5'- TACAATGATGTCAAGCGAAATATGG -3'
Posted On2015-04-06