Incidental Mutation 'R3877:Rcvrn'
ID276913
Institutional Source Beutler Lab
Gene Symbol Rcvrn
Ensembl Gene ENSMUSG00000020907
Gene Namerecoverin
SynonymsS-modulin, cancer associated retinopathy protein, guanylate cyclase activator
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67695326-67703333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67699976 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 129 (I129F)
Ref Sequence ENSEMBL: ENSMUSP00000021290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000021290]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021290
AA Change: I129F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021290
Gene: ENSMUSG00000020907
AA Change: I129F

DomainStartEndE-ValueType
EFh 65 93 2.37e-3 SMART
EFh 101 129 3.27e-6 SMART
Blast:EFh 151 179 9e-9 BLAST
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the recoverin family of neuronal calcium sensors. The encoded protein contains three calcium-binding EF-hand domains and may prolong the termination of the phototransduction cascade in the retina by blocking the phosphorylation of photo-activated rhodopsin. Recoverin may be the antigen responsible for cancer-associated retinopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit faster flash response recovery in dark-adapted rods, decreased sensitivity of rods to steps of light and altered kinetics of sodium/calcium-potassium exchange in rods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Rcvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3875:Rcvrn UTSW 11 67700054 missense probably benign 0.03
R3950:Rcvrn UTSW 11 67700051 missense probably damaging 1.00
R4214:Rcvrn UTSW 11 67695688 missense possibly damaging 0.94
R4916:Rcvrn UTSW 11 67695765 missense probably damaging 1.00
R4979:Rcvrn UTSW 11 67695420 missense probably damaging 1.00
R5009:Rcvrn UTSW 11 67695724 missense probably benign 0.01
R5079:Rcvrn UTSW 11 67702941 missense probably damaging 1.00
R5088:Rcvrn UTSW 11 67695514 missense probably benign 0.17
R5428:Rcvrn UTSW 11 67700049 missense possibly damaging 0.76
R7390:Rcvrn UTSW 11 67700057 missense probably damaging 1.00
X0065:Rcvrn UTSW 11 67700072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATGAGGCTTAGCTCC -3'
(R):5'- AGAGCATGTTCCCCAGTTCTG -3'

Sequencing Primer
(F):5'- AGGCTTAGCTCCCTGTAAGAATG -3'
(R):5'- CCTTCTGGGGTCTCTAGGAAATAGC -3'
Posted On2015-04-06