Incidental Mutation 'R3967:Thoc1'
ID312415
Institutional Source Beutler Lab
Gene Symbol Thoc1
Ensembl Gene ENSMUSG00000024287
Gene NameTHO complex 1
Synonyms3110002N20Rik, NMP-84
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location9958180-9995484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9968787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 186 (V186D)
Ref Sequence ENSEMBL: ENSMUSP00000025137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137]
Predicted Effect probably damaging
Transcript: ENSMUST00000025137
AA Change: V186D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287
AA Change: V186D

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mutations in this gene result in embryonic lethality around implantation in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Thoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Thoc1 APN 18 9989744 missense possibly damaging 0.90
IGL01313:Thoc1 APN 18 9987158 missense probably benign 0.05
IGL01501:Thoc1 APN 18 9986321 missense possibly damaging 0.96
IGL01533:Thoc1 APN 18 9962376 missense probably benign 0.02
IGL01821:Thoc1 APN 18 9993429 missense probably benign
IGL01838:Thoc1 APN 18 9993386 missense possibly damaging 0.94
IGL02193:Thoc1 APN 18 9992863 missense probably benign 0.01
IGL02531:Thoc1 APN 18 9970258 missense probably benign
IGL03203:Thoc1 APN 18 9960483 splice site probably benign
R0724:Thoc1 UTSW 18 9963829 missense probably damaging 1.00
R0831:Thoc1 UTSW 18 9963267 missense probably benign 0.00
R2196:Thoc1 UTSW 18 9986300 missense probably damaging 0.99
R2256:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2257:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2289:Thoc1 UTSW 18 9984488 missense probably damaging 1.00
R2508:Thoc1 UTSW 18 9977947 missense probably damaging 0.99
R2937:Thoc1 UTSW 18 9959255 missense probably damaging 0.96
R4012:Thoc1 UTSW 18 9987651 missense possibly damaging 0.87
R4320:Thoc1 UTSW 18 9960493 missense probably benign
R4686:Thoc1 UTSW 18 9970312 nonsense probably null
R4811:Thoc1 UTSW 18 9993438 missense probably damaging 0.97
R4962:Thoc1 UTSW 18 9962387 missense probably benign 0.01
R5486:Thoc1 UTSW 18 9992204 missense probably benign 0.39
R5648:Thoc1 UTSW 18 9962390 missense possibly damaging 0.94
R6291:Thoc1 UTSW 18 9993330 missense probably benign
R6406:Thoc1 UTSW 18 9977963 missense probably damaging 1.00
R6458:Thoc1 UTSW 18 9993333 missense probably benign
X0057:Thoc1 UTSW 18 9992178 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTATTGTGAGACGCTCGGC -3'
(R):5'- CCAATTCCACAGAACTGTCTTC -3'

Sequencing Primer
(F):5'- CTCGGCAGGCAGAACAAAG -3'
(R):5'- CACAGAACTGTCTTCTAATTTCCATG -3'
Posted On2015-04-29