Incidental Mutation 'R4039:Crnkl1'
ID313827
Institutional Source Beutler Lab
Gene Symbol Crnkl1
Ensembl Gene ENSMUSG00000001767
Gene Namecrooked neck pre-mRNA splicing factor 1
Synonyms5730590A01Rik, crn, 1200013P10Rik
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145917479-145935014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145932327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000001818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001818] [ENSMUST00000116398] [ENSMUST00000118002] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001818
AA Change: D72V

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: D72V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 30 52 N/A INTRINSIC
HAT 61 93 4.57e-2 SMART
HAT 95 127 3.48e-7 SMART
HAT 129 161 3.33e-4 SMART
HAT 163 194 2.48e-3 SMART
HAT 196 227 1.32e-7 SMART
HAT 229 264 2.11e-6 SMART
HAT 266 300 2.07e0 SMART
Blast:HAT 310 342 1e-13 BLAST
HAT 344 378 3.88e-5 SMART
HAT 388 424 6.86e-6 SMART
HAT 426 457 1.92e2 SMART
HAT 459 491 1.29e-1 SMART
HAT 493 527 2e-7 SMART
HAT 529 560 8.07e-3 SMART
coiled coil region 566 596 N/A INTRINSIC
low complexity region 655 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116398
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118002
SMART Domains Protein: ENSMUSP00000113529
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130168
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138774
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147904
Predicted Effect probably benign
Transcript: ENSMUST00000152515
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Crnkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Crnkl1 APN 2 145918468 missense possibly damaging 0.75
IGL01092:Crnkl1 APN 2 145919948 missense probably benign 0.00
IGL01643:Crnkl1 APN 2 145931348 missense probably damaging 0.99
IGL01902:Crnkl1 APN 2 145924712 splice site probably null
IGL01908:Crnkl1 APN 2 145928155 missense probably benign 0.01
IGL01934:Crnkl1 APN 2 145931282 missense probably benign 0.02
IGL01947:Crnkl1 APN 2 145921824 missense probably benign 0.05
IGL02342:Crnkl1 APN 2 145924713 critical splice donor site probably null
IGL02721:Crnkl1 APN 2 145923881 missense possibly damaging 0.90
IGL02794:Crnkl1 APN 2 145930612 missense possibly damaging 0.55
IGL02877:Crnkl1 APN 2 145920671 nonsense probably null
IGL03131:Crnkl1 APN 2 145932258 missense probably benign 0.02
R0326:Crnkl1 UTSW 2 145919955 missense probably benign
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1471:Crnkl1 UTSW 2 145932316 missense possibly damaging 0.69
R1951:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1952:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1953:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R2112:Crnkl1 UTSW 2 145930697 nonsense probably null
R2405:Crnkl1 UTSW 2 145928157 nonsense probably null
R2972:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2973:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2974:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R3801:Crnkl1 UTSW 2 145919795 missense probably benign
R3811:Crnkl1 UTSW 2 145931306 missense probably damaging 1.00
R4037:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4038:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4976:Crnkl1 UTSW 2 145923876 missense possibly damaging 0.86
R5396:Crnkl1 UTSW 2 145928212 missense possibly damaging 0.74
R5868:Crnkl1 UTSW 2 145918553 missense probably benign 0.11
R6245:Crnkl1 UTSW 2 145928131 missense probably benign 0.03
R6564:Crnkl1 UTSW 2 145928245 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AATTACTAGCACAGTACAGGTCC -3'
(R):5'- ATCTTGCAATAGCTACCCCTAC -3'

Sequencing Primer
(F):5'- TAGCACAGTACAGGTCCATGCTTTAC -3'
(R):5'- AACTTTAGAGAAACACCTGTCACTG -3'
Posted On2015-04-30