Incidental Mutation 'R4467:Dtx2'
ID329232
Institutional Source Beutler Lab
Gene Symbol Dtx2
Ensembl Gene ENSMUSG00000004947
Gene Namedeltex 2, E3 ubiquitin ligase
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135994800-136032872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136012076 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 112 (W112R)
Ref Sequence ENSEMBL: ENSMUSP00000142472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827] [ENSMUST00000130345] [ENSMUST00000199239]
Predicted Effect probably damaging
Transcript: ENSMUST00000005072
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 408 468 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111142
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 409 469 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111144
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111145
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125827
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130345
Predicted Effect probably damaging
Transcript: ENSMUST00000199239
AA Change: W112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142472
Gene: ENSMUSG00000004947
AA Change: W112R

DomainStartEndE-ValueType
WWE 17 105 8.4e-34 SMART
WWE 107 151 3.9e-4 SMART
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Dtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Dtx2 APN 5 136029203 missense possibly damaging 0.95
IGL01536:Dtx2 APN 5 136010086 utr 5 prime probably benign
IGL01584:Dtx2 APN 5 136026566 missense possibly damaging 0.49
IGL01782:Dtx2 APN 5 136010127 nonsense probably null
IGL03091:Dtx2 APN 5 136012374 missense probably damaging 1.00
R0499:Dtx2 UTSW 5 136029103 missense probably damaging 1.00
R0580:Dtx2 UTSW 5 136032326 missense probably damaging 1.00
R1988:Dtx2 UTSW 5 136032293 nonsense probably null
R2062:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2063:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2064:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2065:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2068:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2108:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2110:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2111:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2130:Dtx2 UTSW 5 136012040 missense probably damaging 0.96
R2146:Dtx2 UTSW 5 136030610 missense probably benign 0.21
R3108:Dtx2 UTSW 5 136021816 missense probably benign 0.01
R3421:Dtx2 UTSW 5 136012478 missense probably damaging 1.00
R4741:Dtx2 UTSW 5 136026517 missense probably benign 0.00
R5083:Dtx2 UTSW 5 136012190 missense probably damaging 1.00
R5318:Dtx2 UTSW 5 136012100 missense possibly damaging 0.92
R5705:Dtx2 UTSW 5 136010295 missense probably damaging 1.00
R5964:Dtx2 UTSW 5 136023699 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGTCACATGGTCACACAC -3'
(R):5'- AGTCACTGGGTAAACTGGCC -3'

Sequencing Primer
(F):5'- GTGTCACATGGTCACACACACATAC -3'
(R):5'- TGGGTAAACTGGCCCCACTTG -3'
Posted On2015-07-21