Incidental Mutation 'R4467:Brat1'
ID329234
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene NameBRCA1-associated ATM activator 1
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location140705011-140719379 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 140705071 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000041783] [ENSMUST00000077890] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000135028] [ENSMUST00000142081] [ENSMUST00000153440]
Predicted Effect probably benign
Transcript: ENSMUST00000041588
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041783
SMART Domains Protein: ENSMUSP00000045913
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 190 N/A INTRINSIC
coiled coil region 212 266 N/A INTRINSIC
coiled coil region 287 323 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
coiled coil region 398 491 N/A INTRINSIC
IQ 552 574 1.36e-3 SMART
low complexity region 579 598 N/A INTRINSIC
IQ 614 636 1.63e-1 SMART
low complexity region 734 753 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077890
SMART Domains Protein: ENSMUSP00000077050
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
coiled coil region 112 145 N/A INTRINSIC
coiled coil region 167 221 N/A INTRINSIC
coiled coil region 242 278 N/A INTRINSIC
low complexity region 300 317 N/A INTRINSIC
coiled coil region 353 446 N/A INTRINSIC
IQ 507 529 1.36e-3 SMART
low complexity region 534 553 N/A INTRINSIC
IQ 569 591 1.63e-1 SMART
low complexity region 628 647 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 737 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100505
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110806
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect probably benign
Transcript: ENSMUST00000135028
SMART Domains Protein: ENSMUSP00000143397
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139382
Predicted Effect probably benign
Transcript: ENSMUST00000142081
SMART Domains Protein: ENSMUSP00000120637
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149674
Predicted Effect probably benign
Transcript: ENSMUST00000153440
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140717177 missense probably damaging 1.00
IGL01327:Brat1 APN 5 140718208 nonsense probably null
IGL01897:Brat1 APN 5 140717915 missense probably benign 0.00
IGL01965:Brat1 APN 5 140718056 missense probably benign 0.01
IGL02437:Brat1 APN 5 140712808 missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140705995 missense probably damaging 1.00
R0394:Brat1 UTSW 5 140718386 missense probably damaging 1.00
R1256:Brat1 UTSW 5 140710207 missense possibly damaging 0.87
R1426:Brat1 UTSW 5 140718013 missense probably benign 0.00
R1474:Brat1 UTSW 5 140712627 missense probably benign
R1848:Brat1 UTSW 5 140718509 missense possibly damaging 0.94
R2205:Brat1 UTSW 5 140705133 intron probably benign
R3901:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R3902:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R4751:Brat1 UTSW 5 140718296 missense probably damaging 1.00
R5795:Brat1 UTSW 5 140713072 missense probably benign 0.01
R6151:Brat1 UTSW 5 140705961 missense probably benign 0.00
X0026:Brat1 UTSW 5 140714938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGAGACTTGAAGCTGGC -3'
(R):5'- TGACATGCATCGTCCGTAC -3'

Sequencing Primer
(F):5'- AGGTGGAGCCAATTCCCG -3'
(R):5'- GTCCGTACCTCCCAAATCCGG -3'
Posted On2015-07-21