Incidental Mutation 'R4612:Chd3'
ID344859
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
MMRRC Submission 041823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4612 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 69353209 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1249 (Y1249*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]
Predicted Effect probably null
Transcript: ENSMUST00000092971
AA Change: Y1343*
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: Y1343*

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108661
AA Change: Y1343*
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: Y1343*

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122992
Predicted Effect probably null
Transcript: ENSMUST00000128981
AA Change: Y1249*
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: Y1249*

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144332
Predicted Effect probably benign
Transcript: ENSMUST00000151436
SMART Domains Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
Pfam:SNF2_N 1 142 9e-24 PFAM
SCOP:d1gkub2 162 197 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,476 D31G probably benign Het
5730455P16Rik A T 11: 80,377,980 M1K probably null Het
Abca15 A G 7: 120,335,161 D120G probably benign Het
Adam26a A T 8: 43,568,793 N553K probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adam39 A T 8: 40,825,921 S450C probably damaging Het
Agap2 A T 10: 127,080,096 T159S unknown Het
Ahnak G A 19: 9,003,724 V791I probably benign Het
Ak7 T G 12: 105,761,513 L468R probably damaging Het
Akap12 A G 10: 4,354,456 D422G probably damaging Het
Antxr1 T A 6: 87,288,173 I129F probably damaging Het
Arhgap32 G A 9: 32,259,479 G1185D probably damaging Het
Atf7ip2 A T 16: 10,241,563 E322D probably benign Het
Atg4b T C 1: 93,786,541 F349L probably damaging Het
Atp6v1c1 A G 15: 38,677,612 K127R probably damaging Het
Atxn1l C T 8: 109,732,104 V509M possibly damaging Het
B3glct T A 5: 149,739,557 I260N probably damaging Het
Bcl2l12 G A 7: 44,996,585 P70L probably damaging Het
Bok T A 1: 93,694,178 F157L probably damaging Het
Bves G A 10: 45,339,277 G16D probably benign Het
Cacna1b T A 2: 24,626,852 K65* probably null Het
Casc3 A G 11: 98,822,958 T339A probably benign Het
Ccdc18 C T 5: 108,135,441 S6L probably benign Het
Cd86 A G 16: 36,615,330 Y242H probably benign Het
Chrne T C 11: 70,617,022 T284A probably damaging Het
Col12a1 T C 9: 79,616,057 D2746G probably damaging Het
Cryaa T A 17: 31,678,474 M72K probably benign Het
Csmd1 G T 8: 15,921,908 probably null Het
Det1 A T 7: 78,843,706 N183K probably damaging Het
Dis3 C A 14: 99,091,435 V294L probably benign Het
Dnah2 G A 11: 69,483,367 L1493F possibly damaging Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dsg4 T A 18: 20,462,413 S558T probably benign Het
Dzip3 A T 16: 48,952,040 L422* probably null Het
Elp6 T C 9: 110,314,019 F100S probably damaging Het
Epg5 C T 18: 77,982,414 T1224I possibly damaging Het
F830016B08Rik T A 18: 60,301,015 I390N probably benign Het
Fam110c A G 12: 31,074,656 T206A unknown Het
Fam160a1 G A 3: 85,730,372 R207* probably null Het
Fam187b G A 7: 30,977,093 G9D possibly damaging Het
Fat1 A G 8: 45,025,147 D2410G probably damaging Het
Fbln1 T A 15: 85,238,559 F390Y probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Flcn T C 11: 59,792,687 T555A probably damaging Het
Foxq1 G T 13: 31,558,825 probably benign Het
Gm3233 A T 10: 77,759,664 probably benign Het
Gm5346 A T 8: 43,626,550 F212L probably benign Het
Gm7271 A T 5: 76,516,498 N145Y probably damaging Het
Gprc5a G A 6: 135,078,929 V125I probably damaging Het
Gria2 T C 3: 80,732,051 D218G probably damaging Het
Gtf3c5 C T 2: 28,579,584 A103T probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Hspg2 A G 4: 137,539,575 T1964A possibly damaging Het
Htatip2 G T 7: 49,772,597 E188* probably null Het
Ifna13 T G 4: 88,643,876 E170D probably damaging Het
Il4ra A G 7: 125,576,083 T488A probably benign Het
Jup G T 11: 100,381,834 H251N probably damaging Het
Kif21a A T 15: 90,968,223 probably null Het
Klhl28 T A 12: 64,957,260 I160L probably damaging Het
Klk5 A T 7: 43,845,272 T60S possibly damaging Het
Kntc1 A G 5: 123,812,643 R1995G probably damaging Het
Lrig2 A C 3: 104,462,783 I844M probably damaging Het
Lrp2 C T 2: 69,458,427 W3698* probably null Het
Lyar T A 5: 38,224,709 S12T possibly damaging Het
Map3k19 T C 1: 127,815,300 K1507E probably benign Het
Mre11a G A 9: 14,802,903 G267R probably damaging Het
Mthfd1l A G 10: 4,030,717 Q473R probably damaging Het
Ncald T A 15: 37,397,349 E29V probably benign Het
Neb T C 2: 52,287,243 D1362G probably damaging Het
Nme2 T C 11: 93,955,602 T7A possibly damaging Het
Nod2 T A 8: 88,665,036 L657Q possibly damaging Het
Nrm T A 17: 35,863,529 V75E probably benign Het
Ogfod1 A C 8: 94,037,347 K20T possibly damaging Het
Olfr197 T C 16: 59,186,311 I57M probably damaging Het
Olfr294 T A 7: 86,615,736 Q303L probably benign Het
Olfr63 T A 17: 33,269,480 V252E probably benign Het
Omp T C 7: 98,145,141 N93S probably damaging Het
Pcdhb15 A C 18: 37,475,595 T627P probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pogk C A 1: 166,398,765 E606* probably null Het
Ppp1r10 T A 17: 35,927,931 L292Q probably damaging Het
Prpf6 T C 2: 181,632,079 C339R possibly damaging Het
Psd T A 19: 46,313,339 D937V probably benign Het
Rbak T C 5: 143,174,467 Q277R probably benign Het
Sbno1 T A 5: 124,404,024 Y355F probably damaging Het
Sec23ip C T 7: 128,750,502 Q201* probably null Het
Serpinb3a T C 1: 107,047,607 K157E probably damaging Het
Slc22a28 A T 19: 8,101,406 N306K probably damaging Het
Smarca2 C A 19: 26,776,225 D1584E possibly damaging Het
Snx29 C A 16: 11,447,495 Q530K probably damaging Het
Stard10 C A 7: 101,345,670 Q278K possibly damaging Het
Tgm2 C T 2: 158,124,204 C510Y probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Tmco4 T C 4: 138,990,560 W4R probably benign Het
Tmem151a T A 19: 5,071,834 probably benign Het
Tmem255b T C 8: 13,454,228 V140A probably benign Het
Trbj1-2 C T 6: 41,534,016 probably benign Het
Trpm2 T C 10: 77,945,916 T290A probably damaging Het
Tsc22d1 G A 14: 76,419,005 E120K possibly damaging Het
Ttc29 A G 8: 78,325,546 D352G probably benign Het
Usp25 A T 16: 77,033,945 I30F possibly damaging Het
Usp34 A C 11: 23,432,268 N1993T probably damaging Het
Vmn2r124 A C 17: 18,063,022 H326P probably benign Het
Vmn2r92 C A 17: 18,166,870 T157K probably benign Het
Vstm5 A T 9: 15,257,493 I118F probably benign Het
Vwa7 T C 17: 35,023,450 V510A probably damaging Het
Zfhx4 G A 3: 5,397,063 S1266N probably damaging Het
Zfp763 T A 17: 33,018,948 N408Y probably benign Het
Zswim5 C T 4: 116,986,704 H980Y probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
redoubt UTSW 11 69353901 unclassified probably benign
schloss UTSW 11 69362060 nonsense probably null
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0449:Chd3 UTSW 11 69357541 missense probably damaging 0.98
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3845:Chd3 UTSW 11 69346759 missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4635:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7316:Chd3 UTSW 11 69345568 missense probably damaging 0.99
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTCTGAGGTACACTGCTGC -3'
(R):5'- GAAGGAAAGGCATCTCACCC -3'

Sequencing Primer
(F):5'- AGGTACACTGCTGCTTTTTGC -3'
(R):5'- GAGTTTCTGGCCAACACCTCAG -3'
Posted On2015-09-25