Incidental Mutation 'R4603:Ndufs7'
ID345798
Institutional Source Beutler Lab
Gene Symbol Ndufs7
Ensembl Gene ENSMUSG00000020153
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 7
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80249121-80256794 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80256667 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 203 (Y203*)
Ref Sequence ENSEMBL: ENSMUSP00000101003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020359] [ENSMUST00000020361] [ENSMUST00000105363] [ENSMUST00000105364] [ENSMUST00000156935]
Predicted Effect probably benign
Transcript: ENSMUST00000020359
SMART Domains Protein: ENSMUSP00000020359
Gene: ENSMUSG00000020150

DomainStartEndE-ValueType
PDB:1XCL|A 2 252 1e-151 PDB
SCOP:d1khha_ 44 252 3e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020361
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000020361
Gene: ENSMUSG00000020153
AA Change: Y203*

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105363
SMART Domains Protein: ENSMUSP00000101002
Gene: ENSMUSG00000020150

DomainStartEndE-ValueType
PDB:1XCL|A 2 236 1e-155 PDB
SCOP:d1khha_ 44 236 2e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105364
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000101003
Gene: ENSMUSG00000020153
AA Change: Y203*

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155523
Predicted Effect probably benign
Transcript: ENSMUST00000156935
SMART Domains Protein: ENSMUSP00000117497
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 3 75 1.89e-24 SMART
RRM 105 171 6.71e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157063
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Ndufs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ndufs7 APN 10 80256005 nonsense probably null
IGL00940:Ndufs7 APN 10 80255121 missense probably damaging 0.98
R0539:Ndufs7 UTSW 10 80254831 splice site probably benign
R1727:Ndufs7 UTSW 10 80256019 splice site probably benign
R3714:Ndufs7 UTSW 10 80252421 missense probably benign 0.00
R4600:Ndufs7 UTSW 10 80256667 nonsense probably null
R5437:Ndufs7 UTSW 10 80254924 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTTTCCCTGTGGAGCCATGG -3'
(R):5'- CTCAAGAGCCAGGAGTGATCAC -3'

Sequencing Primer
(F):5'- CCATGGACAGCTCAGGGATG -3'
(R):5'- CACAGAGGGTGCAGGACCTG -3'
Posted On2015-09-25