Incidental Mutation 'R4603:Vmn2r94'
ID345822
Institutional Source Beutler Lab
Gene Symbol Vmn2r94
Ensembl Gene ENSMUSG00000090417
Gene Namevomeronasal 2, receptor 94
SynonymsEG665227
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18240994-18277756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18257385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 255 (I255F)
Ref Sequence ENSEMBL: ENSMUSP00000156288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172190] [ENSMUST00000231457] [ENSMUST00000231815]
Predicted Effect probably benign
Transcript: ENSMUST00000172190
AA Change: I255F

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126386
Gene: ENSMUSG00000090417
AA Change: I255F

DomainStartEndE-ValueType
Pfam:ANF_receptor 42 425 1.7e-35 PFAM
Pfam:NCD3G 469 522 3.5e-21 PFAM
Pfam:7tm_3 553 790 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231457
Predicted Effect probably benign
Transcript: ENSMUST00000231815
AA Change: I255F

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Vmn2r94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn2r94 APN 17 18257039 missense probably damaging 1.00
IGL01676:Vmn2r94 APN 17 18257010 missense probably benign
IGL01687:Vmn2r94 APN 17 18253312 missense possibly damaging 0.64
IGL02113:Vmn2r94 APN 17 18257675 missense probably damaging 0.99
IGL02408:Vmn2r94 APN 17 18253261 missense probably benign 0.01
IGL02451:Vmn2r94 APN 17 18258191 missense possibly damaging 0.95
IGL02755:Vmn2r94 APN 17 18244499 missense probably benign 0.01
IGL02822:Vmn2r94 APN 17 18243620 missense probably benign 0.00
IGL02868:Vmn2r94 APN 17 18244054 missense possibly damaging 0.75
IGL03008:Vmn2r94 APN 17 18257646 missense probably benign 0.05
R0112:Vmn2r94 UTSW 17 18243604 missense probably benign
R0371:Vmn2r94 UTSW 17 18257294 missense probably benign 0.11
R0413:Vmn2r94 UTSW 17 18243818 missense probably damaging 0.98
R0627:Vmn2r94 UTSW 17 18257165 missense probably damaging 1.00
R0737:Vmn2r94 UTSW 17 18277433 nonsense probably null
R0815:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R0863:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R1125:Vmn2r94 UTSW 17 18257455 missense probably damaging 1.00
R1276:Vmn2r94 UTSW 17 18257082 missense possibly damaging 0.47
R1491:Vmn2r94 UTSW 17 18257703 missense probably damaging 1.00
R1500:Vmn2r94 UTSW 17 18256980 missense probably benign 0.07
R1610:Vmn2r94 UTSW 17 18243733 missense probably damaging 1.00
R1664:Vmn2r94 UTSW 17 18244144 missense probably damaging 0.99
R1716:Vmn2r94 UTSW 17 18257373 missense probably benign 0.01
R1843:Vmn2r94 UTSW 17 18244470 missense probably benign 0.01
R1882:Vmn2r94 UTSW 17 18244214 missense probably benign 0.07
R1936:Vmn2r94 UTSW 17 18244292 nonsense probably null
R2273:Vmn2r94 UTSW 17 18257331 missense probably benign 0.00
R2508:Vmn2r94 UTSW 17 18257474 missense probably benign 0.32
R3436:Vmn2r94 UTSW 17 18258388 splice site probably benign
R3917:Vmn2r94 UTSW 17 18244358 missense probably benign
R3968:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R3969:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R4257:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R4271:Vmn2r94 UTSW 17 18243678 missense probably damaging 1.00
R4349:Vmn2r94 UTSW 17 18244343 missense probably benign 0.01
R4436:Vmn2r94 UTSW 17 18258383 missense probably damaging 1.00
R4821:Vmn2r94 UTSW 17 18257031 missense probably benign 0.02
R5288:Vmn2r94 UTSW 17 18244466 missense probably damaging 1.00
R5725:Vmn2r94 UTSW 17 18256227 missense possibly damaging 0.88
R5735:Vmn2r94 UTSW 17 18243804 missense probably damaging 1.00
R6066:Vmn2r94 UTSW 17 18257433 missense probably damaging 0.99
R6124:Vmn2r94 UTSW 17 18244059 missense probably benign 0.01
R6189:Vmn2r94 UTSW 17 18257734 missense probably benign 0.25
R6245:Vmn2r94 UTSW 17 18258123 missense probably damaging 1.00
R6574:Vmn2r94 UTSW 17 18256159 missense probably damaging 1.00
R7236:Vmn2r94 UTSW 17 18257549 missense possibly damaging 0.49
R7317:Vmn2r94 UTSW 17 18243620 missense probably benign 0.00
R7398:Vmn2r94 UTSW 17 18257341 missense probably benign 0.00
R7399:Vmn2r94 UTSW 17 18244503 critical splice acceptor site probably null
R7478:Vmn2r94 UTSW 17 18257505 missense probably benign
X0011:Vmn2r94 UTSW 17 18244448 missense possibly damaging 0.76
X0028:Vmn2r94 UTSW 17 18243975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTGGTTTGACACTTGTCC -3'
(R):5'- CTATCAGATTTTAGGGAGGAGATGG -3'

Sequencing Primer
(F):5'- GGTTTGACACTTGTCCAAAACATGAC -3'
(R):5'- TGGAGAGAAACAGAATCTGCATAGC -3'
Posted On2015-09-25