Incidental Mutation 'R4660:Ap1b1'
ID352785
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5016760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 145 (V145E)
Ref Sequence ENSEMBL: ENSMUSP00000105523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably damaging
Transcript: ENSMUST00000009234
AA Change: V145E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: V145E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101613
AA Change: V145E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: V145E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109897
AA Change: V145E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: V145E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144426
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 intron probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCACAGGTGACTCATCC -3'
(R):5'- TTCTAAGGTGGAAAGCTAGGTG -3'

Sequencing Primer
(F):5'- AGGTGACTCATCCCGCCTC -3'
(R):5'- GCTAGGTGAAGGGCCAACC -3'
Posted On2015-10-08