Incidental Mutation 'R4734:Helb'
ID359176
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Namehelicase (DNA) B
SynonymsD10Ertd664e
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location120083608-120112987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120084849 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1063 (D1063G)
Ref Sequence ENSEMBL: ENSMUSP00000020449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000081260] [ENSMUST00000130387] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000154501]
Predicted Effect probably benign
Transcript: ENSMUST00000020449
AA Change: D1063G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: D1063G

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081260
SMART Domains Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 3e-19 SMART
PDZ 166 242 5.2e-19 SMART
PDZ 265 339 8.4e-21 SMART
PDZ 518 590 1.4e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130387
SMART Domains Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 583 655 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148241
Predicted Effect probably benign
Transcript: ENSMUST00000154501
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1423:Helb UTSW 10 120108966 missense probably damaging 0.99
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R2432:Helb UTSW 10 120105537 missense probably benign 0.01
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5663:Helb UTSW 10 120105793 missense possibly damaging 0.61
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R5951:Helb UTSW 10 120091748 missense possibly damaging 0.91
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6183:Helb UTSW 10 120112998 unclassified probably null
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 unclassified probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGTTCATCTTGTCTTGGGAGG -3'
(R):5'- AGGAGCGCATCATTTCTTCC -3'

Sequencing Primer
(F):5'- GTTTTCAgtggtggtgg -3'
(R):5'- TTCCTCAGGCTCGGTCATGG -3'
Posted On2015-11-11