Incidental Mutation 'R4772:Mpp7'
ID367637
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Namemembrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7347962-7626863 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 7379983 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
Predicted Effect probably null
Transcript: ENSMUST00000115869
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7353297 missense probably benign 0.00
IGL01575:Mpp7 APN 18 7403365 splice site probably benign
IGL02973:Mpp7 APN 18 7403297 missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7461637 critical splice donor site probably null
IGL03224:Mpp7 APN 18 7403269 missense probably benign 0.28
IGL03248:Mpp7 APN 18 7403269 missense probably benign 0.28
R0040:Mpp7 UTSW 18 7403180 splice site probably benign
R0089:Mpp7 UTSW 18 7439555 splice site probably benign
R1413:Mpp7 UTSW 18 7350977 missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7350984 missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7350967 makesense probably null
R2379:Mpp7 UTSW 18 7403345 nonsense probably null
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7351085 missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7444062 missense probably benign 0.23
R4574:Mpp7 UTSW 18 7353228 missense probably benign 0.02
R5066:Mpp7 UTSW 18 7513002 missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7458930 critical splice donor site probably null
R5451:Mpp7 UTSW 18 7442855 missense probably null 0.95
R5578:Mpp7 UTSW 18 7355101 missense probably benign
R5651:Mpp7 UTSW 18 7355016 critical splice donor site probably null
R5787:Mpp7 UTSW 18 7461682 missense probably benign
R6979:Mpp7 UTSW 18 7355049 missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7441623 missense probably damaging 1.00
X0028:Mpp7 UTSW 18 7403273 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGGGGATCCTTGAAACTCTGC -3'
(R):5'- GTGATCATTCAGGATTGTTCAGTAC -3'

Sequencing Primer
(F):5'- TTGAAACTCTGCTGGCCCAG -3'
(R):5'- AACCAATCCTTCTCATGTATAGAGC -3'
Posted On2015-12-29