Incidental Mutation 'R4772:Adamts19'
ID367639
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58837776 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 144 (Q144R)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052907
AA Change: Q144R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: Q144R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 58954620 missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59031804 nonsense probably null
R5116:Adamts19 UTSW 18 58902994 missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 58968808 missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 58968774 missense probably benign 0.18
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
R7251:Adamts19 UTSW 18 58837902 missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58837883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCGTGTTTCCTGCACTC -3'
(R):5'- CTGTCCCGGTGTAAAAGCAG -3'

Sequencing Primer
(F):5'- AGTCGCTGAACGCCACG -3'
(R):5'- AAGAGCCAGGGTCAGCC -3'
Posted On2015-12-29