Incidental Mutation 'R4977:Zfp619'
ID382762
Institutional Source Beutler Lab
Gene Symbol Zfp619
Ensembl Gene ENSMUSG00000068959
Gene Namezinc finger protein 619
Synonyms3000002G13Rik
MMRRC Submission 042572-MU
Accession Numbers

Genbank: NM_001004139; MGI: 1917477

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location39517766-39540420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39537387 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 947 (C947Y)
Ref Sequence ENSEMBL: ENSMUSP00000103650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108015]
Predicted Effect probably damaging
Transcript: ENSMUST00000108015
AA Change: C947Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103650
Gene: ENSMUSG00000068959
AA Change: C947Y

DomainStartEndE-ValueType
KRAB 4 61 2.19e-20 SMART
ZnF_C2H2 218 240 2.91e-2 SMART
ZnF_C2H2 246 268 5.81e-2 SMART
ZnF_C2H2 274 296 3.16e-3 SMART
ZnF_C2H2 302 324 2.4e-3 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 380 6.32e-3 SMART
ZnF_C2H2 386 408 8.47e-4 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 1.58e-3 SMART
ZnF_C2H2 470 492 5.42e-2 SMART
ZnF_C2H2 526 548 2.09e-3 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
ZnF_C2H2 582 604 1.56e-2 SMART
ZnF_C2H2 610 632 2.24e-3 SMART
ZnF_C2H2 638 660 4.72e-2 SMART
ZnF_C2H2 666 688 7.78e-3 SMART
ZnF_C2H2 694 716 5.9e-3 SMART
ZnF_C2H2 722 744 1.12e-3 SMART
ZnF_C2H2 748 770 6.42e-4 SMART
ZnF_C2H2 776 798 1.38e-3 SMART
ZnF_C2H2 804 826 9.44e-2 SMART
ZnF_C2H2 832 854 2.36e-2 SMART
ZnF_C2H2 860 882 8.94e-3 SMART
ZnF_C2H2 888 910 3.58e-2 SMART
ZnF_C2H2 916 938 6.42e-4 SMART
ZnF_C2H2 942 964 4.72e-2 SMART
ZnF_C2H2 970 992 2.3e-5 SMART
ZnF_C2H2 998 1020 8.34e-3 SMART
ZnF_C2H2 1026 1048 8.81e-2 SMART
ZnF_C2H2 1054 1076 1.69e-3 SMART
ZnF_C2H2 1082 1104 6.32e-3 SMART
ZnF_C2H2 1110 1132 1.47e-3 SMART
ZnF_C2H2 1138 1160 7.15e-2 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]). See ZNF91 (MIM 603971) for further information on ZNFs.[supplied by OMIM, Aug 2009]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Zfp619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zfp619 APN 7 39534864 missense probably damaging 1.00
IGL02221:Zfp619 APN 7 39536910 missense probably benign 0.00
IGL02625:Zfp619 APN 7 39534185 splice site probably benign
3-1:Zfp619 UTSW 7 39536765 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0113:Zfp619 UTSW 7 39537759 missense probably benign 0.01
R0377:Zfp619 UTSW 7 39536797 nonsense probably null
R0614:Zfp619 UTSW 7 39537675 missense possibly damaging 0.79
R0848:Zfp619 UTSW 7 39536559 missense probably damaging 1.00
R1157:Zfp619 UTSW 7 39536858 missense probably damaging 0.98
R2047:Zfp619 UTSW 7 39537638 missense probably damaging 0.99
R2074:Zfp619 UTSW 7 39534761 missense probably benign 0.00
R2419:Zfp619 UTSW 7 39535883 missense possibly damaging 0.71
R2571:Zfp619 UTSW 7 39537171 missense probably damaging 1.00
R2890:Zfp619 UTSW 7 39534969 missense probably benign 0.00
R3814:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4003:Zfp619 UTSW 7 39537306 missense possibly damaging 0.91
R4059:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4503:Zfp619 UTSW 7 39536856 missense probably damaging 1.00
R4664:Zfp619 UTSW 7 39534135 missense probably benign 0.00
R4696:Zfp619 UTSW 7 39536988 missense probably benign 0.00
R4895:Zfp619 UTSW 7 39537972 missense possibly damaging 0.68
R4975:Zfp619 UTSW 7 39537080 missense possibly damaging 0.90
R5049:Zfp619 UTSW 7 39535514 missense probably benign 0.02
R5240:Zfp619 UTSW 7 39537218 missense possibly damaging 0.68
R5468:Zfp619 UTSW 7 39535728 missense unknown
R5546:Zfp619 UTSW 7 39535153 missense probably benign 0.01
R5572:Zfp619 UTSW 7 39535239 missense probably benign 0.01
R6106:Zfp619 UTSW 7 39535134 missense probably benign 0.01
R6329:Zfp619 UTSW 7 39537545 missense probably damaging 1.00
R6354:Zfp619 UTSW 7 39534819 missense probably benign 0.02
R6395:Zfp619 UTSW 7 39537030 missense possibly damaging 0.91
R6490:Zfp619 UTSW 7 39534162 missense probably benign 0.00
R6560:Zfp619 UTSW 7 39537530 missense probably damaging 1.00
R6713:Zfp619 UTSW 7 39537898 missense probably damaging 0.99
R7011:Zfp619 UTSW 7 39537762 missense probably damaging 1.00
R7022:Zfp619 UTSW 7 39534963 missense probably benign 0.00
R7046:Zfp619 UTSW 7 39537363 missense possibly damaging 0.95
R7206:Zfp619 UTSW 7 39535400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTCACACTGCAGAAAAGC -3'
(R):5'- TTCTCTCCGGTGTGAGATCTCT -3'

Sequencing Primer
(F):5'- AGCGTTCAAAGGCCTCAGTTC -3'
(R):5'- GAAGGACTTCCCACACTGCTTG -3'
Posted On2016-04-27