Incidental Mutation 'R5079:Olfr1136'
ID387001
Institutional Source Beutler Lab
Gene Symbol Olfr1136
Ensembl Gene ENSMUSG00000075151
Gene Nameolfactory receptor 1136
SynonymsMOR177-3, GA_x6K02T2Q125-49193051-49192119
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87692881-87693947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87693208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 225 (V225F)
Ref Sequence ENSEMBL: ENSMUSP00000076681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000099852]
Predicted Effect probably damaging
Transcript: ENSMUST00000077471
AA Change: V225F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: V225F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099852
AA Change: V225F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: V225F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Olfr1136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Olfr1136 APN 2 87693745 missense possibly damaging 0.73
IGL02190:Olfr1136 APN 2 87693063 missense probably benign 0.21
IGL02902:Olfr1136 APN 2 87693000 missense probably damaging 1.00
R0153:Olfr1136 UTSW 2 87693604 missense probably benign 0.05
R0665:Olfr1136 UTSW 2 87693808 missense probably benign 0.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1518:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R1812:Olfr1136 UTSW 2 87693103 missense probably benign 0.01
R1993:Olfr1136 UTSW 2 87693433 missense probably benign 0.07
R2098:Olfr1136 UTSW 2 87693729 missense probably benign 0.25
R3106:Olfr1136 UTSW 2 87693505 missense probably damaging 0.98
R4622:Olfr1136 UTSW 2 87693643 nonsense probably null
R4694:Olfr1136 UTSW 2 87693760 missense probably benign 0.03
R5474:Olfr1136 UTSW 2 87693057 missense probably damaging 1.00
R6432:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R6667:Olfr1136 UTSW 2 87693570 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGACCAATGCTTC -3'
(R):5'- GGCATTCAGCTTATGTTTCTGC -3'

Sequencing Primer
(F):5'- TCAGAGGGTTTATCATAGGGATAAC -3'
(R):5'- TGCCACTCTACTCAGATCAATC -3'
Posted On2016-06-06